Human CTSD/CLN10/ MGC2311 ORF/cDNA clone-Adenovirus plasmid (BC016320)
Pre-made Human CTSD/CLN10/ MGC2311 adenoviral expression plasmid for CTSD adenovirus packaging, CTSD adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to CTSD/CLN10 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAP000223 | Human CTSD Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAP000223 |
Gene Name | CTSD |
Accession Number | BC016320 |
Gene ID | 1509 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 1239 bp |
Gene Alias | CLN10, MGC2311 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCAGCCCTCCAGCCTTCTGCCGCTCGCCCTCTGCCTGCTGGCTGCACCCGCCTCCGCGCTCGTCAGGATCCCGCTGCACAAGTTCACGTCCATCCGCCGGACCATGTCGGAGGTTGGGGGCTCTGTGGAGGACCTGATTGCCAAAGGCCCCGTCTCAAAGTACTCCCAGGCGGTGCCAGCCGTGACCGAGGGGCCCATTCCCGAGGTGCTCAAGAACTACATGGACGCCCAGTACTACGGGGAGATTGGCATCGGGACGCCCCCCCAGTGCTTCACAGTCGTCTTCGACACGGGCTCCTCCAACCTGTGGGTCCCCTCCATCCACTGCAAACTGCTGGACATCGCTTGCTGGATCCACCACAAGTACAACAGCGACAAGTCCAGCACCTACGTGAAGAATGGTACCTCGTTTGACATCCACTATGGCTCGGGCAGCCTCTCCGGGTACCTGAGCCAGGACACTGTGTCGGTGCCCTGCCAGTCAGCGTCGTCAGCCTCTGCCCTGGGCGGTGTCAAAGTGGAGAGGCAGGTCTTTGGGGAGGCCACCAAGCAGCCAGGCATCACCTTCATCGCAGCCAAGTTCGATGGCATCCTGGGCATGGCCTACCCCCGCATCTCCGTCAACAACGTGCTGCCCGTCTTCGACAACCTGATGCAGCAGAAGCTGGTGGACCAGAACATCTTCTCCTTCTACCTGAGCAGGGACCCAGATGCGCAGCCTGGGGGTGAGCTGATGCTGGGTGGCACAGACTCCAAGTATTACAAGGGTTCTCTGTCCTACCTGAATGTCACCCGCAAGGCCTACTGGCAGGTCCACCTGGACCAGGTGGAGGTGGCCAGCGGGCTGACCCTGTGCAAGGAGGGCTGTGAGGCCATTGTGGACACAGGCACTTCCCTCATGGTGGGCCCGGTGGATGAGGTGCGCGAGCTGCAGAAGGCCATCGGGGCCGTGCCGCTGATTCAGGGCGAGTACATGATCCCCTGTGAGAAGGTGTCCACCCTGCCCGCGATCACACTGAAGCTGGGAGGCAAAGGCTACAAGCTGTCCCCAGAGGACTACACGCTCAAGGTGTCGCAGGCCGGGAAGACCCTCTGCCTGAGCGGCTTCATGGGCATGGACATCCCGCCACCCAGCGGGCCACTCTGGATCCTGGGCGACGTCTTCATCGGCCGCTACTACACTGTGTTTGACCGTGACAACAACAGGGTGGGCTTCGCCGAGGCTGCCCGCCTCTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T67102-Ab | Anti-CATD/ CTSD/ CLN10 functional antibody |
Target Antigen | GM-Tg-g-T67102-Ag | CTSD protein |
ORF Viral Vector | pGMAD000913 | Human CTSD Adenovirus plasmid |
ORF Viral Vector | pGMPC000592 | Human CTSD Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP000108 | Human CTSD Lentivirus plasmid |
ORF Viral Vector | pGMAP000192 | Human CTSD Adenovirus plasmid |
ORF Viral Vector | pGMAP000223 | Human CTSD Adenovirus plasmid |
ORF Viral Vector | vGMAD000913 | Human CTSD Adenovirus particle |
ORF Viral Vector | vGMLP000108 | Human CTSD Lentivirus particle |
ORF Viral Vector | vGMAP000192 | Human CTSD Adenovirus particle |
ORF Viral Vector | vGMAP000223 | Human CTSD Adenovirus particle |
Target information
Target ID | GM-T67102 |
Target Name | CTSD |
Gene ID | 1509, 13033, 703534, 171293, 101094625, 483662, 282883, 100629639 |
Gene Symbol and Synonyms | CatD,CD,CLN10,CPSD,CTSD,HEL-S-130P |
Uniprot Accession | P07339 |
Uniprot Entry Name | CATD_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | colorectal cancer, Malignant neoplasm of bladder |
Gene Ensembl | ENSG00000117984 |
Target Classification | Not Available |
This gene encodes a member of the A1 family of peptidases. The encoded preproprotein is proteolytically processed to generate multiple protein products. These products include the cathepsin D light and heavy chains, which heterodimerize to form the mature enzyme. This enzyme exhibits pepsin-like activity and plays a role in protein turnover and in the proteolytic activation of hormones and growth factors. Mutations in this gene play a causal role in neuronal ceroid lipofuscinosis-10 and may be involved in the pathogenesis of several other diseases, including breast cancer and possibly Alzheimer's disease. [provided by RefSeq, Nov 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.