Human CTSD/CLN10/ MGC2311 ORF/cDNA clone-Adenovirus particle (BC016320)

Pre-made Human CTSD/CLN10/ MGC2311 Adenovirus for CTSD overexpression in-vitro and in-vivo. The CTSD adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified CTSD-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to CTSD/CLN10 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000223 Human CTSD Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000223
Gene Name CTSD
Accession Number BC016320
Gene ID 1509
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1239 bp
Gene Alias CLN10, MGC2311
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCAGCCCTCCAGCCTTCTGCCGCTCGCCCTCTGCCTGCTGGCTGCACCCGCCTCCGCGCTCGTCAGGATCCCGCTGCACAAGTTCACGTCCATCCGCCGGACCATGTCGGAGGTTGGGGGCTCTGTGGAGGACCTGATTGCCAAAGGCCCCGTCTCAAAGTACTCCCAGGCGGTGCCAGCCGTGACCGAGGGGCCCATTCCCGAGGTGCTCAAGAACTACATGGACGCCCAGTACTACGGGGAGATTGGCATCGGGACGCCCCCCCAGTGCTTCACAGTCGTCTTCGACACGGGCTCCTCCAACCTGTGGGTCCCCTCCATCCACTGCAAACTGCTGGACATCGCTTGCTGGATCCACCACAAGTACAACAGCGACAAGTCCAGCACCTACGTGAAGAATGGTACCTCGTTTGACATCCACTATGGCTCGGGCAGCCTCTCCGGGTACCTGAGCCAGGACACTGTGTCGGTGCCCTGCCAGTCAGCGTCGTCAGCCTCTGCCCTGGGCGGTGTCAAAGTGGAGAGGCAGGTCTTTGGGGAGGCCACCAAGCAGCCAGGCATCACCTTCATCGCAGCCAAGTTCGATGGCATCCTGGGCATGGCCTACCCCCGCATCTCCGTCAACAACGTGCTGCCCGTCTTCGACAACCTGATGCAGCAGAAGCTGGTGGACCAGAACATCTTCTCCTTCTACCTGAGCAGGGACCCAGATGCGCAGCCTGGGGGTGAGCTGATGCTGGGTGGCACAGACTCCAAGTATTACAAGGGTTCTCTGTCCTACCTGAATGTCACCCGCAAGGCCTACTGGCAGGTCCACCTGGACCAGGTGGAGGTGGCCAGCGGGCTGACCCTGTGCAAGGAGGGCTGTGAGGCCATTGTGGACACAGGCACTTCCCTCATGGTGGGCCCGGTGGATGAGGTGCGCGAGCTGCAGAAGGCCATCGGGGCCGTGCCGCTGATTCAGGGCGAGTACATGATCCCCTGTGAGAAGGTGTCCACCCTGCCCGCGATCACACTGAAGCTGGGAGGCAAAGGCTACAAGCTGTCCCCAGAGGACTACACGCTCAAGGTGTCGCAGGCCGGGAAGACCCTCTGCCTGAGCGGCTTCATGGGCATGGACATCCCGCCACCCAGCGGGCCACTCTGGATCCTGGGCGACGTCTTCATCGGCCGCTACTACACTGTGTTTGACCGTGACAACAACAGGGTGGGCTTCGCCGAGGCTGCCCGCCTCTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T67102-Ab Anti-CATD/ CTSD/ CLN10 functional antibody
    Target Antigen GM-Tg-g-T67102-Ag CTSD protein
    ORF Viral Vector pGMAD000913 Human CTSD Adenovirus plasmid
    ORF Viral Vector pGMPC000592 Human CTSD Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP000108 Human CTSD Lentivirus plasmid
    ORF Viral Vector pGMAP000192 Human CTSD Adenovirus plasmid
    ORF Viral Vector pGMAP000223 Human CTSD Adenovirus plasmid
    ORF Viral Vector vGMAD000913 Human CTSD Adenovirus particle
    ORF Viral Vector vGMLP000108 Human CTSD Lentivirus particle
    ORF Viral Vector vGMAP000192 Human CTSD Adenovirus particle
    ORF Viral Vector vGMAP000223 Human CTSD Adenovirus particle


    Target information

    Target ID GM-T67102
    Target Name CTSD
    Gene ID 1509, 13033, 703534, 171293, 101094625, 483662, 282883, 100629639
    Gene Symbol and Synonyms CatD,CD,CLN10,CPSD,CTSD,HEL-S-130P
    Uniprot Accession P07339
    Uniprot Entry Name CATD_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease colorectal cancer, Malignant neoplasm of bladder
    Gene Ensembl ENSG00000117984
    Target Classification Not Available

    This gene encodes a member of the A1 family of peptidases. The encoded preproprotein is proteolytically processed to generate multiple protein products. These products include the cathepsin D light and heavy chains, which heterodimerize to form the mature enzyme. This enzyme exhibits pepsin-like activity and plays a role in protein turnover and in the proteolytic activation of hormones and growth factors. Mutations in this gene play a causal role in neuronal ceroid lipofuscinosis-10 and may be involved in the pathogenesis of several other diseases, including breast cancer and possibly Alzheimer's disease. [provided by RefSeq, Nov 2015]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.