Human AQP4/HMIWC2/MGC22454 ORF/cDNA clone-Adenovirus plasmid (BC022286)

Cat. No.: pGMAP000272
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human AQP4/HMIWC2/MGC22454 adenoviral expression plasmid for AQP4 adenovirus packaging, AQP4 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.


Target products collection

Go to AQP4/HMIWC2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAP000272
Gene Name AQP4
Accession Number BC022286
Gene ID 361
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 972 bp
Gene Alias HMIWC2,MGC22454,MIWC
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGAGTGACAGACCCACAGCAAGGCGGTGGGGTAAGTGTGGACCTTTGTGTACCAGAGAGAACATCATGGTGGCTTTCAAAGGGGTCTGGACTCAAGCTTTCTGGAAAGCAGTCACAGCGGAATTTCTGGCCATGCTTATTTTTGTTCTCCTCAGCCTGGGATCCACCATCAACTGGGGTGGAACAGAAAAGCCTTTACCGGTCGACATGGTTCTCATCTCCCTTTGCTTTGGACTCAGCATTGCAACCATGGTGCAGTGCTTTGGCCATATCAGCGGTGGCCACATCAACCCTGCAGTGACTGTGGCCATGGTGTGCACCAGGAAGATCAGCATCGCCAAGTCTGTCTTCTACATCGCAGCCCAGTGCCTGGGGGCCATCATTGGAGCAGGAATCCTCTATCTGGTCACACCTCCCAGTGTGGTGGGAGGCCTGGGAGTCACCATGGTTCATGGAAATCTTACCGCTGGTCATGGTCTCCTGGTTGAGTTGATAATCACATTTCAATTGGTGTTTACTATCTTTGCCAGCTGTGATTCCAAACGGACTGATGTCACTGGCTCAATAGCTTTAGCAATTGGATTTTCTGTTGCAATTGGACATTTATTTGCAATCAATTATACTGGTGCCAGCATGAATCCCGCCCGATCCTTTGGACCTGCAGTTATCATGGGAAATTGGGAAAACCATTGGATATATTGGGTTGGGCCCATCATAGGAGCTGTCCTCGCTGGTGGCCTTTATGAGTATGTCTTCTGTCCAGATGTTGAATTCAAACGTCGTTTTAAAGAAGCCTTCAGCAAAGCTGCCCAGCAAACAAAAGGAAGCTACATGGAGGTGGAGGACAACAGGAGTCAGGTAGAGACGGATGACCTGATTCTAAAACCTGGAGTGGTGCATGTGATTGACGTTGACCGGGGAGAGGAGAAGAAGGGGAAAGACCAATCTGGAGAGGTATTGTCTTCAGTATGA
ORF Protein Sequence MSDRPTARRWGKCGPLCTRENIMVAFKGVWTQAFWKAVTAEFLAMLIFVLLSLGSTINWGGTEKPLPVDMVLISLCFGLSIATMVQCFGHISGGHINPAVTVAMVCTRKISIAKSVFYIAAQCLGAIIGAGILYLVTPPSVVGGLGVTMVHGNLTAGHGLLVELIITFQLVFTIFASCDSKRTDVTGSIALAIGFSVAIGHLFAINYTGASMNPARSFGPAVIMGNWENHWIYWVGPIIGAVLAGGLYEYVFCPDVEFKRRFKEAFSKAAQQTKGSYMEVEDNRSQVETDDLILKPGVVHVIDVDRGEEKKGKDQSGEVLSSV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0080-Ab Anti-AQP4/ MIWC/ WCH4 monoclonal antibody
    Target Antigen GM-Tg-g-MP0080-Ag AQP4 VLP (virus-like particle)
    ORF Viral Vector pGMAP000272 Human AQP4 Adenovirus plasmid
    ORF Viral Vector vGMAP000272 Human AQP4 Adenovirus particle


    Target information

    Target ID GM-MP0080
    Target Name AQP4
    Gene ID 361, 11829, 703773, 25293, 101081006, 612628, 281008, 100051905
    Gene Symbol and Synonyms AQP-4,AQP4,hAQP4,MIWC,WCH4
    Uniprot Accession P55087
    Uniprot Entry Name AQP4_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Diagnostics Biomarker
    Disease Not Available
    Gene Ensembl ENSG00000171885
    Target Classification Not Available

    This gene encodes a member of the aquaporin family of intrinsic membrane proteins that function as water-selective channels in the plasma membranes of many cells. This protein is the predominant aquaporin found in brain and has an important role in brain water homeostasis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. Additional isoforms, resulting from the use of alternative in-frame translation initiation codons, have also been described. Recent studies provided evidence for translational readthrough in this gene, and expression of C-terminally extended isoforms via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Jun 2018]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.