Human AQP4/HMIWC2/MGC22454 ORF/cDNA clone-Adenovirus particle (BC022286)

Cat. No.: vGMAP000272

Pre-made Human AQP4/HMIWC2/MGC22454 Adenovirus for AQP4 overexpression in-vitro and in-vivo. The AQP4 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified AQP4-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to AQP4/HMIWC2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000272 Human AQP4 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000272
Gene Name AQP4
Accession Number BC022286
Gene ID 361
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 972 bp
Gene Alias HMIWC2,MGC22454,MIWC
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGAGTGACAGACCCACAGCAAGGCGGTGGGGTAAGTGTGGACCTTTGTGTACCAGAGAGAACATCATGGTGGCTTTCAAAGGGGTCTGGACTCAAGCTTTCTGGAAAGCAGTCACAGCGGAATTTCTGGCCATGCTTATTTTTGTTCTCCTCAGCCTGGGATCCACCATCAACTGGGGTGGAACAGAAAAGCCTTTACCGGTCGACATGGTTCTCATCTCCCTTTGCTTTGGACTCAGCATTGCAACCATGGTGCAGTGCTTTGGCCATATCAGCGGTGGCCACATCAACCCTGCAGTGACTGTGGCCATGGTGTGCACCAGGAAGATCAGCATCGCCAAGTCTGTCTTCTACATCGCAGCCCAGTGCCTGGGGGCCATCATTGGAGCAGGAATCCTCTATCTGGTCACACCTCCCAGTGTGGTGGGAGGCCTGGGAGTCACCATGGTTCATGGAAATCTTACCGCTGGTCATGGTCTCCTGGTTGAGTTGATAATCACATTTCAATTGGTGTTTACTATCTTTGCCAGCTGTGATTCCAAACGGACTGATGTCACTGGCTCAATAGCTTTAGCAATTGGATTTTCTGTTGCAATTGGACATTTATTTGCAATCAATTATACTGGTGCCAGCATGAATCCCGCCCGATCCTTTGGACCTGCAGTTATCATGGGAAATTGGGAAAACCATTGGATATATTGGGTTGGGCCCATCATAGGAGCTGTCCTCGCTGGTGGCCTTTATGAGTATGTCTTCTGTCCAGATGTTGAATTCAAACGTCGTTTTAAAGAAGCCTTCAGCAAAGCTGCCCAGCAAACAAAAGGAAGCTACATGGAGGTGGAGGACAACAGGAGTCAGGTAGAGACGGATGACCTGATTCTAAAACCTGGAGTGGTGCATGTGATTGACGTTGACCGGGGAGAGGAGAAGAAGGGGAAAGACCAATCTGGAGAGGTATTGTCTTCAGTATGA
ORF Protein Sequence MSDRPTARRWGKCGPLCTRENIMVAFKGVWTQAFWKAVTAEFLAMLIFVLLSLGSTINWGGTEKPLPVDMVLISLCFGLSIATMVQCFGHISGGHINPAVTVAMVCTRKISIAKSVFYIAAQCLGAIIGAGILYLVTPPSVVGGLGVTMVHGNLTAGHGLLVELIITFQLVFTIFASCDSKRTDVTGSIALAIGFSVAIGHLFAINYTGASMNPARSFGPAVIMGNWENHWIYWVGPIIGAVLAGGLYEYVFCPDVEFKRRFKEAFSKAAQQTKGSYMEVEDNRSQVETDDLILKPGVVHVIDVDRGEEKKGKDQSGEVLSSV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0080-Ab Anti-AQP4/ MIWC/ WCH4 monoclonal antibody
    Target Antigen GM-Tg-g-MP0080-Ag AQP4 VLP (virus-like particle)
    ORF Viral Vector pGMAP000272 Human AQP4 Adenovirus plasmid
    ORF Viral Vector vGMAP000272 Human AQP4 Adenovirus particle


    Target information

    Target ID GM-MP0080
    Target Name AQP4
    Gene ID 361, 11829, 703773, 25293, 101081006, 612628, 281008, 100051905
    Gene Symbol and Synonyms AQP-4,AQP4,hAQP4,MIWC,WCH4
    Uniprot Accession P55087
    Uniprot Entry Name AQP4_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Diagnostics Biomarker
    Disease Not Available
    Gene Ensembl ENSG00000171885
    Target Classification Not Available

    This gene encodes a member of the aquaporin family of intrinsic membrane proteins that function as water-selective channels in the plasma membranes of many cells. This protein is the predominant aquaporin found in brain and has an important role in brain water homeostasis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. Additional isoforms, resulting from the use of alternative in-frame translation initiation codons, have also been described. Recent studies provided evidence for translational readthrough in this gene, and expression of C-terminally extended isoforms via the use of an alternative in-frame translation termination codon. [provided by RefSeq, Jun 2018]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.