Human CDK6/MGC59692/ PLSTIRE ORF/cDNA clone-Adenovirus plasmid (BC052264)

Pre-made Human CDK6/MGC59692/ PLSTIRE adenoviral expression plasmid for CDK6 adenovirus packaging, CDK6 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to CDK6/MGC59692 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP000280 Human CDK6 Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP000280
Gene Name CDK6
Accession Number BC052264
Gene ID 1021
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 981 bp
Gene Alias MGC59692, PLSTIRE
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAGAAGGACGGCCTGTGCCGCGCTGACCAGCAGTACGAATGCGTGGCGGAGATCGGGGAGGGCGCCTATGGGAAGGTGTTCAAGGCCCGCGACTTGAAGAACGGAGGCCGTTTCGTGGCGTTGAAGCGCGTGCGGGTGCAGACCGGCGAGGAGGGCATGCCGCTCTCCACCATCCGCGAGGTGGCGGTGCTGAGGCACCTGGAGACCTTCGAGCACCCCAACGTGGTCAGGTTGTTTGATGTGTGCACAGTGTCACGAACAGACAGAGAAACCAAACTAACTTTAGTGTTTGAACATGTCGATCAAGACTTGACCACTTACTTGGATAAAGTTCCAGAGCCTGGAGTGCCCACTGAAACCATAAAGGATATGATGTTTCAGCTTCTCCGAGGTCTGGACTTTCTTCATTCACACCGAGTAGTGCATCGCGATCTAAAACCACAGAACATTCTGGTGACCAGCAGCGGACAAATAAAACTCGCTGACTTCGGCCTTGCCCGCATCTATAGTTTCCAGATGGCTCTAACCTCAGTGGTCGTCACGCTGTGGTACAGAGCACCCGAAGTCTTGCTCCAGTCCAGCTACGCCACCCCCGTGGATCTCTGGAGTGTTGGCTGCATATTTGCAGAAATGTTTCGTAGAAAGCCTCTTTTTCGTGGAAGTTCAGATGTTGATCAACTAGGAAAAATCTTGGACGTGATTGGACTCCCAGGAGAAGAAGACTGGCCTAGAGATGTTGCCCTTCCCAGGCAGGCTTTTCATTCAAAATCTGCCCAACCAATTGAGAAGTTTGTAACAGATATCGATGAACTAGGCAAAGACCTACTTCTGAAGTGTTTGACATTTAACCCAGCCAAAAGAATATCTGCCTACAGTGCCCTGTCTCACCCATACTTCCAGGACCTGGAAAGGTGCAAAGAAAACCTGGATTCCCACCTGCCGCCCAGCCAGAACACCTCGGAGCTGAATACAGCCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T89361-Ab Anti-CDK6 monoclonal antibody
    Target Antigen GM-Tg-g-T89361-Ag CDK6 protein
    ORF Viral Vector pGMPC000873 Human CDK6 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP000458 Human CDK6 Lentivirus plasmid
    ORF Viral Vector pGMAP000280 Human CDK6 Adenovirus plasmid
    ORF Viral Vector vGMLP000458 Human CDK6 Lentivirus particle
    ORF Viral Vector vGMAP000280 Human CDK6 Adenovirus particle


    Target information

    Target ID GM-T89361
    Target Name CDK6
    Gene ID 1021, 12571, 701822, 114483, 100037415, 609920, 511754, 100061625
    Gene Symbol and Synonyms CDK6,Crk2,MCPH12,PLSTIRE
    Uniprot Accession Q00534
    Uniprot Entry Name CDK6_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease breast tumor
    Gene Ensembl ENSG00000105810
    Target Classification Kinase

    The protein encoded by this gene is a member of the CMGC family of serine/threonine protein kinases. This kinase is a catalytic subunit of the protein kinase complex that is important for cell cycle G1 phase progression and G1/S transition. The activity of this kinase first appears in mid-G1 phase, which is controlled by the regulatory subunits including D-type cyclins and members of INK4 family of CDK inhibitors. This kinase, as well as CDK4, has been shown to phosphorylate, and thus regulate the activity of, tumor suppressor protein Rb. Altered expression of this gene has been observed in multiple human cancers. A mutation in this gene resulting in reduced cell proliferation, and impaired cell motility and polarity, and has been identified in patients with primary microcephaly. [provided by RefSeq, Aug 2017]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.