Human RETN/ADSF/ FIZZ3 ORF/cDNA clone-Adenovirus plasmid (BC069302)
Pre-made Human RETN/ADSF/ FIZZ3 adenoviral expression plasmid for RETN adenovirus packaging, RETN adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to RETN/ADSF products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAP000284 | Human RETN Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAP000284 |
Gene Name | RETN |
Accession Number | BC069302 |
Gene ID | 56729 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 327 bp |
Gene Alias | ADSF, FIZZ3, RETN1, RSTN, XCP1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAAAGCTCTCTGTCTCCTCCTCCTCCCTGTCCTGGGGCTGTTGGTGTCTAGCAAGACCCTGTGCTCCATGGAAGAAGCCATCAATGAGAGGATCCAGGAGGTCGCCGGCTCCCTAATATTTAGGGCAATAAGCAGCATTGGCCTGGAGTGCCAGAGCGTCACCTCCAGGGGGGACCTGGCTACTTGCCCCCGAGGCTTCGCCGTCACCGGCTGCACTTGTGGCTCCGCCTGTGGCTCGTGGGATGTGCGCGCCGAGACCACATGTCACTGCCAGTGCGCGGGCATGGACTGGACCGGAGCGCGCTGCTGTCGTGTGCAGCCCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1239-Ab | Anti-RETN/ ADSF/ FIZZ31 functional antibody |
Target Antigen | GM-Tg-g-SE1239-Ag | RETN protein |
Cytokine | cks-Tg-g-GM-SE1239 | resistin (RETN) protein & antibody |
ORF Viral Vector | pGMLP001996 | Human RETN Lentivirus plasmid |
ORF Viral Vector | pGMAP000284 | Human RETN Adenovirus plasmid |
ORF Viral Vector | vGMLP001996 | Human RETN Lentivirus particle |
ORF Viral Vector | vGMAP000284 | Human RETN Adenovirus particle |
Target information
Target ID | GM-SE1239 |
Target Name | RETN |
Gene ID | 56729, 57264, 708781, 246250, 100142685, 611540, 369020, 100060741 |
Gene Symbol and Synonyms | ADSF,FIZZ3,RENT,RETN,RETN1,RSTN,XCP1,Xcp4 |
Uniprot Accession | Q9HD89 |
Uniprot Entry Name | RETN_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Cytokine Target |
Disease | Sepsis, Malignant neoplasm of bladder |
Gene Ensembl | ENSG00000104918 |
Target Classification | Not Available |
This gene belongs to the family defined by the mouse resistin-like genes. The characteristic feature of this family is the C-terminal stretch of 10 cys residues with identical spacing. The mouse homolog of this protein is secreted by adipocytes, and may be the hormone potentially linking obesity to type II diabetes. The encoded protein also has an antimicrobial role in skin, displaying antibacterial activity against both Gram positive and Gram negative bacteria. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.