Human RETN/ADSF/ FIZZ3 ORF/cDNA clone-Lentivirus particle (NM_001193374.1)
Pre-made Human RETN/ADSF/ FIZZ3 Lentiviral expression plasmid for RETN lentivirus packaging, RETN lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to RETN/ADSF products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP001996 | Human RETN Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP001996 |
Gene Name | RETN |
Accession Number | NM_001193374.1 |
Gene ID | 56729 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 327 bp |
Gene Alias | ADSF, FIZZ3, RETN1, RSTN, XCP1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAAAGCTCTCTGTCTCCTCCTCCTCCCTGTCCTGGGGCTGTTGGTGTCTAGCAAGACCCTGTGCTCCATGGAAGAAGCCATCAATGAGAGGATCCAGGAGGTCGCCGGCTCCCTAATATTTAGGGCAATAAGCAGCATTGGCCTGGAGTGCCAGAGCGTCACCTCCAGGGGGGACCTGGCTACTTGCCCCCGAGGCTTCGCCGTCACCGGCTGCACTTGTGGCTCCGCCTGTGGCTCGTGGGATGTGCGCGCCGAGACCACATGTCACTGCCAGTGCGCGGGCATGGACTGGACCGGAGCGCGCTGCTGTCGTGTGCAGCCCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1239-Ab | Anti-RETN/ ADSF/ FIZZ31 functional antibody |
Target Antigen | GM-Tg-g-SE1239-Ag | RETN protein |
Cytokine | cks-Tg-g-GM-SE1239 | resistin (RETN) protein & antibody |
ORF Viral Vector | pGMLP001996 | Human RETN Lentivirus plasmid |
ORF Viral Vector | pGMAP000284 | Human RETN Adenovirus plasmid |
ORF Viral Vector | vGMLP001996 | Human RETN Lentivirus particle |
ORF Viral Vector | vGMAP000284 | Human RETN Adenovirus particle |
Target information
Target ID | GM-SE1239 |
Target Name | RETN |
Gene ID | 56729, 57264, 708781, 246250, 100142685, 611540, 369020, 100060741 |
Gene Symbol and Synonyms | ADSF,FIZZ3,RENT,RETN,RETN1,RSTN,XCP1,Xcp4 |
Uniprot Accession | Q9HD89 |
Uniprot Entry Name | RETN_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Cytokine Target |
Disease | Sepsis, Malignant neoplasm of bladder |
Gene Ensembl | ENSG00000104918 |
Target Classification | Not Available |
This gene belongs to the family defined by the mouse resistin-like genes. The characteristic feature of this family is the C-terminal stretch of 10 cys residues with identical spacing. The mouse homolog of this protein is secreted by adipocytes, and may be the hormone potentially linking obesity to type II diabetes. The encoded protein also has an antimicrobial role in skin, displaying antibacterial activity against both Gram positive and Gram negative bacteria. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.