Human RETN/ADSF/ FIZZ3 ORF/cDNA clone-Adenovirus particle (BC069302)

Pre-made Human RETN/ADSF/ FIZZ3 Adenovirus for RETN overexpression in-vitro and in-vivo. The RETN adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified RETN-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to RETN/ADSF products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000284 Human RETN Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000284
Gene Name RETN
Accession Number BC069302
Gene ID 56729
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 327 bp
Gene Alias ADSF, FIZZ3, RETN1, RSTN, XCP1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAAGCTCTCTGTCTCCTCCTCCTCCCTGTCCTGGGGCTGTTGGTGTCTAGCAAGACCCTGTGCTCCATGGAAGAAGCCATCAATGAGAGGATCCAGGAGGTCGCCGGCTCCCTAATATTTAGGGCAATAAGCAGCATTGGCCTGGAGTGCCAGAGCGTCACCTCCAGGGGGGACCTGGCTACTTGCCCCCGAGGCTTCGCCGTCACCGGCTGCACTTGTGGCTCCGCCTGTGGCTCGTGGGATGTGCGCGCCGAGACCACATGTCACTGCCAGTGCGCGGGCATGGACTGGACCGGAGCGCGCTGCTGTCGTGTGCAGCCCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1239-Ab Anti-RETN/ ADSF/ FIZZ31 functional antibody
    Target Antigen GM-Tg-g-SE1239-Ag RETN protein
    Cytokine cks-Tg-g-GM-SE1239 resistin (RETN) protein & antibody
    ORF Viral Vector pGMLP001996 Human RETN Lentivirus plasmid
    ORF Viral Vector pGMAP000284 Human RETN Adenovirus plasmid
    ORF Viral Vector vGMLP001996 Human RETN Lentivirus particle
    ORF Viral Vector vGMAP000284 Human RETN Adenovirus particle


    Target information

    Target ID GM-SE1239
    Target Name RETN
    Gene ID 56729, 57264, 708781, 246250, 100142685, 611540, 369020, 100060741
    Gene Symbol and Synonyms ADSF,FIZZ3,RENT,RETN,RETN1,RSTN,XCP1,Xcp4
    Uniprot Accession Q9HD89
    Uniprot Entry Name RETN_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Cytokine Target
    Disease Sepsis, Malignant neoplasm of bladder
    Gene Ensembl ENSG00000104918
    Target Classification Not Available

    This gene belongs to the family defined by the mouse resistin-like genes. The characteristic feature of this family is the C-terminal stretch of 10 cys residues with identical spacing. The mouse homolog of this protein is secreted by adipocytes, and may be the hormone potentially linking obesity to type II diabetes. The encoded protein also has an antimicrobial role in skin, displaying antibacterial activity against both Gram positive and Gram negative bacteria. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2020]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.