Human KCNMA1/BKTM/KCa1.1 ORF/cDNA clone-Adenovirus plasmid (BC062659)

Cat. No.: pGMAP000298
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human KCNMA1/BKTM/KCa1.1 adenoviral expression plasmid for KCNMA1 adenovirus packaging, KCNMA1 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to KCNMA1/BKTM products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAP000298
Gene Name KCNMA1
Accession Number BC062659
Gene ID 3778
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 507 bp
Gene Alias BKTM,KCa1.1,MaxiK,SAKCA,SLO-ALPHA
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGGCAAATGGTGGCGGCGGCGGCGGCGGCAGCAGCGGCGGCGGCGGCGGCGGCGGAGGCAGCAGTCTTAGAATGAGTAGCAATATCCACGCGAACCATCTCAGCCTAGACGCGTCCTCCTCCTCCTCCTCCTCCTCTTCCTCTTCTTCTTCTTCCTCCTCCTCTTCCTCCTCGTCCTCGGTCCACGAGCCCAAGATGGATGCGCTCATCATCCCGGTGACCATGGAGGTGCCGTGCGACAGCCGGGGCCAACGCATGTGGTGGGCTTTCCTGGCCTCCTCCATGGTGACTTTCTTCGGGGGCCTCTTCATCATCTTGCTCTGGCGGACGCTCAAGTACCTGTGGACCGTGTGCTGCCACTGCGGGGGCAAGACGAAGGCCACCCACTTTGGGTCCCCGGAAATGCCACCAGCAGCGCGGAGCTGGAGCGGGAGTCCGCCTGAGGCCGCGGTTTTACGCGGAGCGTCTTCCCTGGCGCTCGAGGTGGCTAGATGTCGTCGGCTTTAG
ORF Protein Sequence MANGGGGGGGSSGGGGGGGGSSLRMSSNIHANHLSLDASSSSSSSSSSSSSSSSSSSSSSVHEPKMDALIIPVTMEVPCDSRGQRMWWAFLASSMVTFFGGLFIILLWRTLKYLWTVCCHCGGKTKATHFGSPEMPPAARSWSGSPPEAAVLRGASSLALEVARCRRL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T66538-Ab Anti-KCMA1/ KCNMA1/ BKTM monoclonal antibody
    Target Antigen GM-Tg-g-T66538-Ag KCNMA1 VLP (virus-like particle)
    ORF Viral Vector pGMAP000298 Human KCNMA1 Adenovirus plasmid
    ORF Viral Vector vGMAP000298 Human KCNMA1 Adenovirus particle


    Target information

    Target ID GM-T66538
    Target Name KCNMA1
    Gene ID 3778, 16531, 574103, 83731, 101099080, 403984, 282573, 100064366
    Gene Symbol and Synonyms 5730414M22Rik,bA205K10.1,BKCa,BKCA alpha,BKTM,CADEDS,cbv1,hSlo,IEG16,k(VCA)alpha,KCa1.1,Kcnma,KCNMA1,KCNMA1b,KCNMA1c,LIWAS,MaxiK,mSlo,mSLO1,PNKD3,SAKCA,SLO,SLO-ALPHA,SLO1
    Uniprot Accession Q12791
    Uniprot Entry Name KCMA1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Calculus of kidney
    Gene Ensembl ENSG00000156113
    Target Classification Not Available

    MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit, which is the product of this gene, and the modulatory beta subunit. Intracellular calcium regulates the physical association between the alpha and beta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.