Human KCNMA1/BKTM/KCa1.1 ORF/cDNA clone-Adenovirus particle (BC062659)
Cat. No.: vGMAP000298
Pre-made Human KCNMA1/BKTM/KCa1.1 Adenovirus for KCNMA1 overexpression in-vitro and in-vivo. The KCNMA1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified KCNMA1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
KCNMA1/BKTM products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAP000298 | Human KCNMA1 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAP000298 |
| Gene Name | KCNMA1 |
| Accession Number | BC062659 |
| Gene ID | 3778 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 507 bp |
| Gene Alias | BKTM,KCa1.1,MaxiK,SAKCA,SLO-ALPHA |
| Fluorescent Reporter | GFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGCAAATGGTGGCGGCGGCGGCGGCGGCAGCAGCGGCGGCGGCGGCGGCGGCGGAGGCAGCAGTCTTAGAATGAGTAGCAATATCCACGCGAACCATCTCAGCCTAGACGCGTCCTCCTCCTCCTCCTCCTCCTCTTCCTCTTCTTCTTCTTCCTCCTCCTCTTCCTCCTCGTCCTCGGTCCACGAGCCCAAGATGGATGCGCTCATCATCCCGGTGACCATGGAGGTGCCGTGCGACAGCCGGGGCCAACGCATGTGGTGGGCTTTCCTGGCCTCCTCCATGGTGACTTTCTTCGGGGGCCTCTTCATCATCTTGCTCTGGCGGACGCTCAAGTACCTGTGGACCGTGTGCTGCCACTGCGGGGGCAAGACGAAGGCCACCCACTTTGGGTCCCCGGAAATGCCACCAGCAGCGCGGAGCTGGAGCGGGAGTCCGCCTGAGGCCGCGGTTTTACGCGGAGCGTCTTCCCTGGCGCTCGAGGTGGCTAGATGTCGTCGGCTTTAG |
| ORF Protein Sequence | MANGGGGGGGSSGGGGGGGGSSLRMSSNIHANHLSLDASSSSSSSSSSSSSSSSSSSSSSVHEPKMDALIIPVTMEVPCDSRGQRMWWAFLASSMVTFFGGLFIILLWRTLKYLWTVCCHCGGKTKATHFGSPEMPPAARSWSGSPPEAAVLRGASSLALEVARCRRL |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T66538-Ab | Anti-KCMA1/ KCNMA1/ BKTM monoclonal antibody |
| Target Antigen | GM-Tg-g-T66538-Ag | KCNMA1 VLP (virus-like particle) |
| ORF Viral Vector | pGMAP000298 | Human KCNMA1 Adenovirus plasmid |
| ORF Viral Vector | vGMAP000298 | Human KCNMA1 Adenovirus particle |
Target information
| Target ID | GM-T66538 |
| Target Name | KCNMA1 |
| Gene ID | 3778, 16531, 574103, 83731, 101099080, 403984, 282573, 100064366 |
| Gene Symbol and Synonyms | 5730414M22Rik,bA205K10.1,BKCa,BKCA alpha,BKTM,CADEDS,cbv1,hSlo,IEG16,k(VCA)alpha,KCa1.1,Kcnma,KCNMA1,KCNMA1b,KCNMA1c,LIWAS,MaxiK,mSlo,mSLO1,PNKD3,SAKCA,SLO,SLO-ALPHA,SLO1 |
| Uniprot Accession | Q12791 |
| Uniprot Entry Name | KCMA1_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target |
| Disease | Calculus of kidney |
| Gene Ensembl | ENSG00000156113 |
| Target Classification | Not Available |
MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit, which is the product of this gene, and the modulatory beta subunit. Intracellular calcium regulates the physical association between the alpha and beta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


