Human KCNMA1/BKTM/KCa1.1 ORF/cDNA clone-Adenovirus particle (BC062659)

Cat. No.: vGMAP000298

Pre-made Human KCNMA1/BKTM/KCa1.1 Adenovirus for KCNMA1 overexpression in-vitro and in-vivo. The KCNMA1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified KCNMA1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to KCNMA1/BKTM products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000298 Human KCNMA1 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000298
Gene Name KCNMA1
Accession Number BC062659
Gene ID 3778
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 507 bp
Gene Alias BKTM,KCa1.1,MaxiK,SAKCA,SLO-ALPHA
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGGCAAATGGTGGCGGCGGCGGCGGCGGCAGCAGCGGCGGCGGCGGCGGCGGCGGAGGCAGCAGTCTTAGAATGAGTAGCAATATCCACGCGAACCATCTCAGCCTAGACGCGTCCTCCTCCTCCTCCTCCTCCTCTTCCTCTTCTTCTTCTTCCTCCTCCTCTTCCTCCTCGTCCTCGGTCCACGAGCCCAAGATGGATGCGCTCATCATCCCGGTGACCATGGAGGTGCCGTGCGACAGCCGGGGCCAACGCATGTGGTGGGCTTTCCTGGCCTCCTCCATGGTGACTTTCTTCGGGGGCCTCTTCATCATCTTGCTCTGGCGGACGCTCAAGTACCTGTGGACCGTGTGCTGCCACTGCGGGGGCAAGACGAAGGCCACCCACTTTGGGTCCCCGGAAATGCCACCAGCAGCGCGGAGCTGGAGCGGGAGTCCGCCTGAGGCCGCGGTTTTACGCGGAGCGTCTTCCCTGGCGCTCGAGGTGGCTAGATGTCGTCGGCTTTAG
ORF Protein Sequence MANGGGGGGGSSGGGGGGGGSSLRMSSNIHANHLSLDASSSSSSSSSSSSSSSSSSSSSSVHEPKMDALIIPVTMEVPCDSRGQRMWWAFLASSMVTFFGGLFIILLWRTLKYLWTVCCHCGGKTKATHFGSPEMPPAARSWSGSPPEAAVLRGASSLALEVARCRRL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T66538-Ab Anti-KCMA1/ KCNMA1/ BKTM monoclonal antibody
    Target Antigen GM-Tg-g-T66538-Ag KCNMA1 VLP (virus-like particle)
    ORF Viral Vector pGMAP000298 Human KCNMA1 Adenovirus plasmid
    ORF Viral Vector vGMAP000298 Human KCNMA1 Adenovirus particle


    Target information

    Target ID GM-T66538
    Target Name KCNMA1
    Gene ID 3778, 16531, 574103, 83731, 101099080, 403984, 282573, 100064366
    Gene Symbol and Synonyms 5730414M22Rik,bA205K10.1,BKCa,BKCA alpha,BKTM,CADEDS,cbv1,hSlo,IEG16,k(VCA)alpha,KCa1.1,Kcnma,KCNMA1,KCNMA1b,KCNMA1c,LIWAS,MaxiK,mSlo,mSLO1,PNKD3,SAKCA,SLO,SLO-ALPHA,SLO1
    Uniprot Accession Q12791
    Uniprot Entry Name KCMA1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Calculus of kidney
    Gene Ensembl ENSG00000156113
    Target Classification Not Available

    MaxiK channels are large conductance, voltage and calcium-sensitive potassium channels which are fundamental to the control of smooth muscle tone and neuronal excitability. MaxiK channels can be formed by 2 subunits: the pore-forming alpha subunit, which is the product of this gene, and the modulatory beta subunit. Intracellular calcium regulates the physical association between the alpha and beta subunits. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.