Human BDNF/MGC34632 ORF/cDNA clone-Adenovirus plasmid (BC029795)

Pre-made Human BDNF/MGC34632 adenoviral expression plasmid for BDNF adenovirus packaging, BDNF adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to BDNF/MGC34632 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP000316 Human BDNF Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP000316
Gene Name BDNF
Accession Number BC029795
Gene ID 627
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 744 bp
Gene Alias MGC34632
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACCATCCTTTTCCTTACTATGGTTATTTCATACTTTGGTTGCATGAAGGCTGCCCCCATGAAAGAAGCAAACATCCGAGGACAAGGTGGCTTGGCCTACCCAGGTGTGCGGACCCATGGGACTCTGGAGAGCGTGAATGGGCCCAAGGCAGGTTCAAGAGGCTTGACATCATTGGCTGACACTTTCGAACACATGATAGAAGAGCTGTTGGATGAGGACCAGAAAGTTCGGCCCAATGAAGAAAACAATAAGGACGCAGACTTGTACACGTCCAGGGTGATGCTCAGTAGTCAAGTGCCTTTGGAGCCTCCTCTTCTCTTTCTGCTGGAGGAATACAAAAATTACCTAGACGCTGCAAACATGTCCATGAGGGTCCGGCGCCACTCTGACCCTGCCCGCCGAGGGGAGCTGAGCGTGTGTGACAGTATTAGTGAGTGGGTAACGGCGGCAGACAAAAAGACTGCAGTGGACATGTCGGGCGGGACGGTCACAGTCCTTGAAAAGGTCCCTGTATCAAAAGGCCAACTGAAGCAATACTTCTACGAGACCAAGTGCAATCCCATGGGTTACACAAAAGAAGGCTGCAGGGGCATAGACAAAAGGCATTGGAACTCCCAGTGCCGAACTACCCAGTCGTACGTGCGGGCCCTTACCATGGATAGCAAAAAGAGAATTGGCTGGCGATTCATAAGGATAGACACTTCTTGTGTATGTACATTGACCATTAAAAGGGGAAGATAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T93122-Ab Anti-BDNF/ ANON2/ BULN2 functional antibody
    Target Antigen GM-Tg-g-T93122-Ag BDNF protein
    ORF Viral Vector pGMAD000577 Human BDNF Adenovirus plasmid
    ORF Viral Vector pGMAAV000124 Rat Bdnf Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV000286 Rat Bdnf Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAAV000575 Human BDNF Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMPC000136 Human BDNF Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000188 Human BDNF Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP004025 Human BDNF Lentivirus plasmid
    ORF Viral Vector pGMAP000316 Human BDNF Adenovirus plasmid
    ORF Viral Vector vGMAD000577 Human BDNF Adenovirus particle
    ORF Viral Vector vGMAAV000124 Rat Bdnf Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV000286 Rat Bdnf Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAAV000575 Human BDNF Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP004025 Human BDNF Lentivirus particle
    ORF Viral Vector vGMAP000316 Human BDNF Adenovirus particle


    Target information

    Target ID GM-T93122
    Target Name BDNF
    Gene ID 627, 12064, 701245, 24225, 493690, 403461, 617701, 100009689
    Gene Symbol and Synonyms ANON2,BDNF,BULN2
    Uniprot Accession P23560
    Uniprot Entry Name BDNF_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Prostate Cancer, ovarian cancer, Overactive bladder, Autism, mental retardation, Allergic reactions, Asthma, Parkinson's Disease
    Gene Ensembl ENSG00000176697
    Target Classification Not Available

    This gene encodes a member of the nerve growth factor family of proteins. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed to generate the mature protein. Binding of this protein to its cognate receptor promotes neuronal survival in the adult brain. Expression of this gene is reduced in Alzheimer's, Parkinson's, and Huntington's disease patients. This gene may play a role in the regulation of the stress response and in the biology of mood disorders. [provided by RefSeq, Nov 2015]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.