Human AKR1B1/ADR/ AR ORF/cDNA clone-Adenovirus plasmid (BC000260)
Pre-made Human AKR1B1/ADR/ AR adenoviral expression plasmid for AKR1B1 adenovirus packaging, AKR1B1 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to AKR1B1/ADR products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAP000366 | Human AKR1B1 Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAP000366 |
Gene Name | AKR1B1 |
Accession Number | BC000260 |
Gene ID | 231 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 951 bp |
Gene Alias | ADR, AR, MGC1804 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCAAGCCGTCTCCTGCTCAACAACGGCGCCAAGATGCCCATCCTGGGGTTGGGTACCTGGAAGTCCCCTCCAGGGCAGGTGACTGAGGCCGTGAAGGTGGCCATTGACGTCGGGTACCGCCACATCGACTGTGCCCATGTGTACCAGAATGAGAATGAGGTGGGGGTGGCCATTCAGGAGAAGCTCAGGGAGCAGGTGGTGAAGCGTGAGGAGCTCTTCATCGTCAGCAAGCTGTGGTGCACGTACCATGAGAAGGGCCTGGTGAAAGGAGCCTGCCAGAAGACACTCAGCGACCTGAAGCTGGACTACCTGGACCTCTACCTTATTCACTGGCCGACTGGCTTTAAGCCTGGGAAGGAATTTTTCCCATTGGATGAGTCGGGCAATGTGGTTCCCAGTGACACCAACATTCTGGACACGTGGGCGGCCATGGAAGAGCTGGTGGATGAAGGGCTGGTGAAAGCTATTGGCATCTCCAACTTCAACCATCTCCAGGTGGAGATGATCTTAAACAAACCTGGCTTGAAGTATAAGCCTGCAGTTAACCAGATTGAGTGCCACCCATATCTCACTCAGGAGAAGTTAATCCAGTACTGCCAGTCCAAAGGCATCGTGGTGACCGCCTACAGCCCCCTCGGCTCTCCTGACAGGCCCTGGGCCAAGCCCGAGGACCCTTCTCTCCTGGAGGATCCCAGGATCAAGGCGATCGCAGCCAAGCACAATAAAACTACAGCCCAGGTCCTGATCCGGTTCCCCATGCAGAGGAACTTGGTGGTGATCCCCAAGTCTGTGACACCAGAACGCATTGCTGAGAACTTTAAGGTCTTTGACTTTGAACTGAGCAGCCAGGATATGACCACCTTACTCAGCTACAACAGGAACTGGAGGGTCTGTGCCTTGTTGAGCTGTACCTCCCACAAGGATTACCCCTTCCATGAAGAGTTTTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T26623-Ab | Anti-AKR1B1 monoclonal antibody |
Target Antigen | GM-Tg-g-T26623-Ag | AKR1B1 protein |
ORF Viral Vector | pGMLP000471 | Human AKR1B1 Lentivirus plasmid |
ORF Viral Vector | pGMAP000366 | Human AKR1B1 Adenovirus plasmid |
ORF Viral Vector | vGMLP000471 | Human AKR1B1 Lentivirus particle |
ORF Viral Vector | vGMAP000366 | Human AKR1B1 Adenovirus particle |
Target information
Target ID | GM-T26623 |
Target Name | AKR1B1 |
Gene ID | 231, 11677, 101095406, 607537, 100065145 |
Gene Symbol and Synonyms | ADR,Ahr-1,Ahr1,AKR1B1,Akr1b3,Aldor1,ALDR1,ALR2,AR |
Uniprot Accession | P15121 |
Uniprot Entry Name | ALDR_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Breast Cancer |
Gene Ensembl | ENSG00000085662 |
Target Classification | Not Available |
This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. This member catalyzes the reduction of a number of aldehydes, including the aldehyde form of glucose, and is thereby implicated in the development of diabetic complications by catalyzing the reduction of glucose to sorbitol. Multiple pseudogenes have been identified for this gene. The nomenclature system used by the HUGO Gene Nomenclature Committee to define human aldo-keto reductase family members is known to differ from that used by the Mouse Genome Informatics database. [provided by RefSeq, Feb 2009]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.