Human AKR1B1/ADR/ AR ORF/cDNA clone-Adenovirus particle (BC000260)

Pre-made Human AKR1B1/ADR/ AR Adenovirus for AKR1B1 overexpression in-vitro and in-vivo. The AKR1B1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified AKR1B1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to AKR1B1/ADR products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000366 Human AKR1B1 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000366
Gene Name AKR1B1
Accession Number BC000260
Gene ID 231
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 951 bp
Gene Alias ADR, AR, MGC1804
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCAAGCCGTCTCCTGCTCAACAACGGCGCCAAGATGCCCATCCTGGGGTTGGGTACCTGGAAGTCCCCTCCAGGGCAGGTGACTGAGGCCGTGAAGGTGGCCATTGACGTCGGGTACCGCCACATCGACTGTGCCCATGTGTACCAGAATGAGAATGAGGTGGGGGTGGCCATTCAGGAGAAGCTCAGGGAGCAGGTGGTGAAGCGTGAGGAGCTCTTCATCGTCAGCAAGCTGTGGTGCACGTACCATGAGAAGGGCCTGGTGAAAGGAGCCTGCCAGAAGACACTCAGCGACCTGAAGCTGGACTACCTGGACCTCTACCTTATTCACTGGCCGACTGGCTTTAAGCCTGGGAAGGAATTTTTCCCATTGGATGAGTCGGGCAATGTGGTTCCCAGTGACACCAACATTCTGGACACGTGGGCGGCCATGGAAGAGCTGGTGGATGAAGGGCTGGTGAAAGCTATTGGCATCTCCAACTTCAACCATCTCCAGGTGGAGATGATCTTAAACAAACCTGGCTTGAAGTATAAGCCTGCAGTTAACCAGATTGAGTGCCACCCATATCTCACTCAGGAGAAGTTAATCCAGTACTGCCAGTCCAAAGGCATCGTGGTGACCGCCTACAGCCCCCTCGGCTCTCCTGACAGGCCCTGGGCCAAGCCCGAGGACCCTTCTCTCCTGGAGGATCCCAGGATCAAGGCGATCGCAGCCAAGCACAATAAAACTACAGCCCAGGTCCTGATCCGGTTCCCCATGCAGAGGAACTTGGTGGTGATCCCCAAGTCTGTGACACCAGAACGCATTGCTGAGAACTTTAAGGTCTTTGACTTTGAACTGAGCAGCCAGGATATGACCACCTTACTCAGCTACAACAGGAACTGGAGGGTCTGTGCCTTGTTGAGCTGTACCTCCCACAAGGATTACCCCTTCCATGAAGAGTTTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T26623-Ab Anti-AKR1B1 monoclonal antibody
    Target Antigen GM-Tg-g-T26623-Ag AKR1B1 protein
    ORF Viral Vector pGMLP000471 Human AKR1B1 Lentivirus plasmid
    ORF Viral Vector pGMAP000366 Human AKR1B1 Adenovirus plasmid
    ORF Viral Vector vGMLP000471 Human AKR1B1 Lentivirus particle
    ORF Viral Vector vGMAP000366 Human AKR1B1 Adenovirus particle


    Target information

    Target ID GM-T26623
    Target Name AKR1B1
    Gene ID 231, 11677, 101095406, 607537, 100065145
    Gene Symbol and Synonyms ADR,Ahr-1,Ahr1,AKR1B1,Akr1b3,Aldor1,ALDR1,ALR2,AR
    Uniprot Accession P15121
    Uniprot Entry Name ALDR_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Breast Cancer
    Gene Ensembl ENSG00000085662
    Target Classification Not Available

    This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. This member catalyzes the reduction of a number of aldehydes, including the aldehyde form of glucose, and is thereby implicated in the development of diabetic complications by catalyzing the reduction of glucose to sorbitol. Multiple pseudogenes have been identified for this gene. The nomenclature system used by the HUGO Gene Nomenclature Committee to define human aldo-keto reductase family members is known to differ from that used by the Mouse Genome Informatics database. [provided by RefSeq, Feb 2009]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.