Human FASLG/CD178/ CD95L ORF/cDNA clone-Adenovirus plasmid (BC017502)
Pre-made Human FASLG/CD178/ CD95L adenoviral expression plasmid for FASLG adenovirus packaging, FASLG adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to CD178/FASLG products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAP000429 | Human FASLG Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAP000429 |
Gene Name | FASLG |
Accession Number | BC017502 |
Gene ID | 356 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 846 bp |
Gene Alias | CD178, CD95L, FASL |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCAGCAGCCCTTCAATTACCCATATCCCCAGATCTACTGGGTGGACAGCAGTGCCAGCTCTCCCTGGGCCCCTCCAGGCACAGTTCTTCCCTGTCCAACCTCTGTGCCCAGAAGGCCTGGTCAAAGGAGGCCACCACCACCACCGCCACCGCCACCACTACCACCTCCGCCGCCGCCGCCACCACTGCCTCCACTACCGCTGCCACCCCTGAAGAAGAGAGGGAACCACAGCACAGGCCTGTGTCTCCTTGTGATGTTTTTCATGGTTCTGGTTGCCTTGGTAGGATTGGGCCTGGGGATGTTTCAGCTCTTCCACCTACAGAAGGAGCTGGCAGAACTCCGAGAGTCTACCAGCCAGATGCACACAGCATCATCTTTGGAGAAGCAAATAGGCCACCCCAGTCCACCCCCTGAAAAAAAGGAGCTGAGGAAAGTGGCCCATTTAACAGGCAAGTCCAACTCAAGGTCCATGCCTCTGGAATGGGAAGACACCTATGGAATTGTCCTGCTTTCTGGAGTGAAGTATAAGAAGGGTGGCCTTGTGATCAATGAAACTGGGCTGTACTTTGTATATTCCAAAGTATACTTCCGGGGTCAATCTTGCAACAACCTGCCCCTGAGCCACAAGGTCTACATGAGGAACTCTAAGTATCCCCAGGATCTGGTGATGATGGAGGGGAAGATGATGAGCTACTGCACTACTGGGCAGATGTGGGCCCGCAGCAGCTACCTGGGGGCAGTGTTCAATCTTACCAGTGCTGATCATTTATATGTCAACGTATCTGAGCTCTCTCTGGTCAATTTTGAGGAATCTCAGACGTTTTTCGGCTTATATAAGCTCTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Biosimilar | GMP-Bios-INN-741 | Pre-Made Asunercept Biosimilar, Fusion Protein targeting FASLG/CD178 fused with human IGHG1 Fc (Fragment constant): Recombinant therapeutic protein targeting ALPS1B/APT1LG1/APTL/CD95-L/CD95L/FASL/TNFSF6/TNLG1A |
Target Antibody | GM-Tg-g-T64245-Ab | Anti-TNFL6/ CD178/ FASLG monoclonal antibody |
Target Antigen | GM-Tg-g-T64245-Ag | CD178/FASLG VLP (virus-like particle) |
Cytokine | cks-Tg-g-GM-T64245 | Fas ligand (TNF superfamily, member 6) (FASL) protein & antibody |
ORF Viral Vector | pGMLV000739 | Rat Faslg Lentivirus plasmid |
ORF Viral Vector | pGMLP000545 | Human FASLG Lentivirus plasmid |
ORF Viral Vector | pGMAP000429 | Human FASLG Adenovirus plasmid |
ORF Viral Vector | vGMLV000739 | Rat Faslg Lentivirus particle |
ORF Viral Vector | vGMLP000545 | Human FASLG Lentivirus particle |
ORF Viral Vector | vGMAP000429 | Human FASLG Adenovirus particle |
Target information
Target ID | GM-T64245 |
Target Name | CD178 |
Gene ID | 356, 14103, 574159, 25385, 493945, 442968, 407111, 100052326 |
Gene Symbol and Synonyms | ALPS1B,APT1LG1,APTL,CD178,CD95-L,CD95L,Fas-L,FASL,FASLG,gld,TNFSF6,TNLG1A |
Uniprot Accession | P48023 |
Uniprot Entry Name | TNFL6_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, INN Index, Cytokine Target |
Disease | Malignant neoplasm of bladder |
Gene Ensembl | ENSG00000117560 |
Target Classification | Not Available |
This gene is a member of the tumor necrosis factor superfamily. The primary function of the encoded transmembrane protein is the induction of apoptosis triggered by binding to FAS. The FAS/FASLG signaling pathway is essential for immune system regulation, including activation-induced cell death (AICD) of T cells and cytotoxic T lymphocyte induced cell death. It has also been implicated in the progression of several cancers. Defects in this gene may be related to some cases of systemic lupus erythematosus (SLE). Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.