Human FASLG/CD178/ CD95L ORF/cDNA clone-Adenovirus plasmid (BC017502)

Pre-made Human FASLG/CD178/ CD95L adenoviral expression plasmid for FASLG adenovirus packaging, FASLG adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to CD178/FASLG products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP000429 Human FASLG Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP000429
Gene Name FASLG
Accession Number BC017502
Gene ID 356
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 846 bp
Gene Alias CD178, CD95L, FASL
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCAGCAGCCCTTCAATTACCCATATCCCCAGATCTACTGGGTGGACAGCAGTGCCAGCTCTCCCTGGGCCCCTCCAGGCACAGTTCTTCCCTGTCCAACCTCTGTGCCCAGAAGGCCTGGTCAAAGGAGGCCACCACCACCACCGCCACCGCCACCACTACCACCTCCGCCGCCGCCGCCACCACTGCCTCCACTACCGCTGCCACCCCTGAAGAAGAGAGGGAACCACAGCACAGGCCTGTGTCTCCTTGTGATGTTTTTCATGGTTCTGGTTGCCTTGGTAGGATTGGGCCTGGGGATGTTTCAGCTCTTCCACCTACAGAAGGAGCTGGCAGAACTCCGAGAGTCTACCAGCCAGATGCACACAGCATCATCTTTGGAGAAGCAAATAGGCCACCCCAGTCCACCCCCTGAAAAAAAGGAGCTGAGGAAAGTGGCCCATTTAACAGGCAAGTCCAACTCAAGGTCCATGCCTCTGGAATGGGAAGACACCTATGGAATTGTCCTGCTTTCTGGAGTGAAGTATAAGAAGGGTGGCCTTGTGATCAATGAAACTGGGCTGTACTTTGTATATTCCAAAGTATACTTCCGGGGTCAATCTTGCAACAACCTGCCCCTGAGCCACAAGGTCTACATGAGGAACTCTAAGTATCCCCAGGATCTGGTGATGATGGAGGGGAAGATGATGAGCTACTGCACTACTGGGCAGATGTGGGCCCGCAGCAGCTACCTGGGGGCAGTGTTCAATCTTACCAGTGCTGATCATTTATATGTCAACGTATCTGAGCTCTCTCTGGTCAATTTTGAGGAATCTCAGACGTTTTTCGGCTTATATAAGCTCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-741 Pre-Made Asunercept Biosimilar, Fusion Protein targeting FASLG/CD178 fused with human IGHG1 Fc (Fragment constant): Recombinant therapeutic protein targeting ALPS1B/APT1LG1/APTL/CD95-L/CD95L/FASL/TNFSF6/TNLG1A
    Target Antibody GM-Tg-g-T64245-Ab Anti-TNFL6/ CD178/ FASLG monoclonal antibody
    Target Antigen GM-Tg-g-T64245-Ag CD178/FASLG VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T64245 Fas ligand (TNF superfamily, member 6) (FASL) protein & antibody
    ORF Viral Vector pGMLV000739 Rat Faslg Lentivirus plasmid
    ORF Viral Vector pGMLP000545 Human FASLG Lentivirus plasmid
    ORF Viral Vector pGMAP000429 Human FASLG Adenovirus plasmid
    ORF Viral Vector vGMLV000739 Rat Faslg Lentivirus particle
    ORF Viral Vector vGMLP000545 Human FASLG Lentivirus particle
    ORF Viral Vector vGMAP000429 Human FASLG Adenovirus particle


    Target information

    Target ID GM-T64245
    Target Name CD178
    Gene ID 356, 14103, 574159, 25385, 493945, 442968, 407111, 100052326
    Gene Symbol and Synonyms ALPS1B,APT1LG1,APTL,CD178,CD95-L,CD95L,Fas-L,FASL,FASLG,gld,TNFSF6,TNLG1A
    Uniprot Accession P48023
    Uniprot Entry Name TNFL6_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, INN Index, Cytokine Target
    Disease Malignant neoplasm of bladder
    Gene Ensembl ENSG00000117560
    Target Classification Not Available

    This gene is a member of the tumor necrosis factor superfamily. The primary function of the encoded transmembrane protein is the induction of apoptosis triggered by binding to FAS. The FAS/FASLG signaling pathway is essential for immune system regulation, including activation-induced cell death (AICD) of T cells and cytotoxic T lymphocyte induced cell death. It has also been implicated in the progression of several cancers. Defects in this gene may be related to some cases of systemic lupus erythematosus (SLE). Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2014]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.