Human SPP1/BSPI/ ETA-1 ORF/cDNA clone-Adenovirus plasmid (BC017387)
Pre-made Human SPP1/BSPI/ ETA-1 adenoviral expression plasmid for SPP1 adenovirus packaging, SPP1 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to SPP1/BSPI products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAP000451 | Human SPP1 Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAP000451 |
Gene Name | SPP1 |
Accession Number | BC017387 |
Gene ID | 6696 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 945 bp |
Gene Alias | BSPI, ETA-1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGAATTGCAGTGATTTGCTTTTGCCTCCTAGGCATCACCTGTGCCATACCAGTTAAACAGGCTGATTCTGGAAGTTCTGAGGAAAAGCAGCTTTACAACAAATACCCAGATGCTGTGGCCACATGGCTAAACCCTGACCCATCTCAGAAGCAGAATCTCCTAGCCCCACAGAATGCTGTGTCCTCTGAAGAAACCAATGACTTTAAACAAGAGACCCTTCCAAGTAAGTCCAACGAAAGCCATGACCACATGGATGATATGGATGATGAAGATGATGATGACCATGTGGACAGCCAGGACTCCATTGACTCGAACGACTCTGATGATGTAGATGACACTGATGATTCTCACCAGTCTGATGAGTCTCACCATTCTGATGAATCTGATGAACTGGTCACTGATTTTCCCACGGACCTGCCAGCAACCGAAGTTTTCACTCCAGTTGTCCCCACAGTAGACACATATGATGGCCGAGGTGATAGTGTGGTTTATGGACTGAGGTCAAAATCTAAGAAGTTTCGCAGACCTGACATCCAGTACCCTGATGCTACAGACGAGGACATCACCTCACACATGGAAAGCGAGGAGTTGAATGGTGCATACAAGGCCATCCCCGTTGCCCAGGACCTGAACGCGCCTTCTGATTGGGACAGCCGTGGGAAGGACAGTTATGAAACGAGTCAGCTGGATGACCAGAGTGCTGAAACCCACAGCCACAAGCAGTCCAGATTATATAAGCGGAAAGCCAATGATGAGAGCAATGAGCATTCCGATGTGATTGATAGTCAGGAACTTTCCAAAGTCAGCCGTGAATTCCACAGCCATGAATTTCACAGCCATGAAGATATGCTGGTTGTAGACCCCAAAAGTAAGGAAGAAGATAAACACCTGAAATTTCGTATTTCTCATGAATTAGATAGTGCATCTTCTGAGGTCAATTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T00032-Ab | Anti-OSTP/ SPP1/ BNSP functional antibody |
Target Antigen | GM-Tg-g-T00032-Ag | SPP1 protein |
ORF Viral Vector | pGMLV000419 | Human SPP1 Lentivirus plasmid |
ORF Viral Vector | pGMLV001852 | Human SPP1 Lentivirus plasmid |
ORF Viral Vector | pGMAD000016 | Human SPP1 Adenovirus plasmid |
ORF Viral Vector | pGMAD000037 | Human SPP1 Adenovirus plasmid |
ORF Viral Vector | pGMPC000786 | Human SPP1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMAP000451 | Human SPP1 Adenovirus plasmid |
ORF Viral Vector | vGMLV000419 | Human SPP1 Lentivirus particle |
ORF Viral Vector | vGMLV001852 | Human SPP1 Lentivirus particle |
ORF Viral Vector | vGMAD000016 | Human SPP1 Adenovirus particle |
ORF Viral Vector | vGMAD000037 | Human SPP1 Adenovirus particle |
ORF Viral Vector | vGMAP000451 | Human SPP1 Adenovirus particle |
Target information
Target ID | GM-T00032 |
Target Name | SPP1 |
Gene ID | 6696, 20750, 704930, 25353, 101094264, 478471, 281499, 100053029 |
Gene Symbol and Synonyms | 2AR,Apl-1,BNSP,Bsp,BSPI,Eta,ETA-1,OP,OPN,Opnl,OSP,OST,Ric,Spp-1,SPP1 |
Uniprot Accession | P10451 |
Uniprot Entry Name | OSTP_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Ovarian cancer, Acute kidney failure, Asphyxia neonatorum, Calculus of kidney, Congenital occlusion of ureteropelvic junction, Contact with and (suspected) exposure to uranium, Dent disease, Hepatic fibrosis, Malignant neoplasm of bladder, Pregnant state, Sepsis |
Gene Ensembl | ENSG00000118785 |
Target Classification | Not Available |
The protein encoded by this gene is involved in the attachment of osteoclasts to the mineralized bone matrix. The encoded protein is secreted and binds hydroxyapatite with high affinity. The osteoclast vitronectin receptor is found in the cell membrane and may be involved in the binding to this protein. This protein is also a cytokine that upregulates expression of interferon-gamma and interleukin-12. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.