Human SPP1/BNSP/BSPI ORF/cDNA clone-Lentivirus plasmid (NM_001040058.2)
Cat. No.: pGMLV001852
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human SPP1/BNSP/BSPI Lentiviral expression plasmid for SPP1 lentivirus packaging, SPP1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
SPP1/BNSP products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMLV001852 |
| Gene Name | SPP1 |
| Accession Number | NM_001040058.2 |
| Gene ID | 6696 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 945 bp |
| Gene Alias | BNSP,BSPI,ETA-1,OPN |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGAGAATTGCAGTGATTTGCTTTTGCCTCCTAGGCATCACCTGTGCCATACCAGTTAAACAGGCTGATTCTGGAAGTTCTGAGGAAAAGCAGCTTTACAACAAATACCCAGATGCTGTGGCCACATGGCTAAACCCTGACCCATCTCAGAAGCAGAATCTCCTAGCCCCACAGAATGCTGTGTCCTCTGAAGAAACCAATGACTTTAAACAAGAGACCCTTCCAAGTAAGTCCAACGAAAGCCATGACCACATGGATGATATGGATGATGAAGATGATGATGACCATGTGGACAGCCAGGACTCCATTGACTCGAACGACTCTGATGATGTAGATGACACTGATGATTCTCACCAGTCTGATGAGTCTCACCATTCTGATGAATCTGATGAACTGGTCACTGATTTTCCCACGGACCTGCCAGCAACCGAAGTTTTCACTCCAGTTGTCCCCACAGTAGACACATATGATGGCCGAGGTGATAGTGTGGTTTATGGACTGAGGTCAAAATCTAAGAAGTTTCGCAGACCTGACATCCAGTACCCTGATGCTACAGACGAGGACATCACCTCACACATGGAAAGCGAGGAGTTGAATGGTGCATACAAGGCCATCCCCGTTGCCCAGGACCTGAACGCGCCTTCTGATTGGGACAGCCGTGGGAAGGACAGTTATGAAACGAGTCAGCTGGATGACCAGAGTGCTGAAACCCACAGCCACAAGCAGTCCAGATTATATAAGCGGAAAGCCAATGATGAGAGCAATGAGCATTCCGATGTGATTGATAGTCAGGAACTTTCCAAAGTCAGCCGTGAATTCCACAGCCATGAATTTCACAGCCATGAAGATATGCTGGTTGTAGACCCCAAAAGTAAGGAAGAAGATAAACACCTGAAATTTCGTATTTCTCATGAATTAGATAGTGCATCTTCTGAGGTCAATTAA |
| ORF Protein Sequence | MRIAVICFCLLGITCAIPVKQADSGSSEEKQLYNKYPDAVATWLNPDPSQKQNLLAPQNAVSSEETNDFKQETLPSKSNESHDHMDDMDDEDDDDHVDSQDSIDSNDSDDVDDTDDSHQSDESHHSDESDELVTDFPTDLPATEVFTPVVPTVDTYDGRGDSVVYGLRSKSKKFRRPDIQYPDATDEDITSHMESEELNGAYKAIPVAQDLNAPSDWDSRGKDSYETSQLDDQSAETHSHKQSRLYKRKANDESNEHSDVIDSQELSKVSREFHSHEFHSHEDMLVVDPKSKEEDKHLKFRISHELDSASSEVN |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T00032-Ab | Anti-OSTP/ SPP1/ BNSP functional antibody |
| Target Antigen | GM-Tg-g-T00032-Ag | SPP1 protein |
| ORF Viral Vector | pGMLV000419 | Human SPP1 Lentivirus plasmid |
| ORF Viral Vector | pGMLV001852 | Human SPP1 Lentivirus plasmid |
| ORF Viral Vector | pGMAD000016 | Human SPP1 Adenovirus plasmid |
| ORF Viral Vector | pGMAD000037 | Human SPP1 Adenovirus plasmid |
| ORF Viral Vector | pGMAD001612 | Human SPP1 Adenovirus plasmid |
| ORF Viral Vector | pGMAP000451 | Human SPP1 Adenovirus plasmid |
| ORF Viral Vector | pGMPC000786 | Human SPP1 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | vGMLV000419 | Human SPP1 Lentivirus particle |
| ORF Viral Vector | vGMLV001852 | Human SPP1 Lentivirus particle |
| ORF Viral Vector | vGMAD000016 | Human SPP1 Adenovirus particle |
| ORF Viral Vector | vGMAD000037 | Human SPP1 Adenovirus particle |
| ORF Viral Vector | vGMAD001612 | Human SPP1 Adenovirus particle |
| ORF Viral Vector | vGMAP000451 | Human SPP1 Adenovirus particle |
Target information
| Target ID | GM-T00032 |
| Target Name | SPP1 |
| Gene ID | 6696, 20750, 704930, 25353, 101094264, 478471, 281499, 100053029 |
| Gene Symbol and Synonyms | 2AR,Apl-1,BNSP,Bsp,BSPI,Eta,ETA-1,OP,OPN,Opnl,OSP,OST,Ric,Spp-1,SPP1 |
| Uniprot Accession | P10451 |
| Uniprot Entry Name | OSTP_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target |
| Disease | Ovarian cancer, Acute kidney failure, Asphyxia neonatorum, Calculus of kidney, Congenital occlusion of ureteropelvic junction, Contact with and (suspected) exposure to uranium, Dent disease, Hepatic fibrosis, Malignant neoplasm of bladder, Pregnant state, Sepsis |
| Gene Ensembl | ENSG00000118785 |
| Target Classification | Not Available |
The protein encoded by this gene is involved in the attachment of osteoclasts to the mineralized bone matrix. The encoded protein is secreted and binds hydroxyapatite with high affinity. The osteoclast vitronectin receptor is found in the cell membrane and may be involved in the binding to this protein. This protein is also a cytokine that upregulates expression of interferon-gamma and interleukin-12. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


