Human PSMD10/dJ889N15.2/p28 ORF/cDNA clone-Adenovirus plasmid (BC011960)

Cat. No.: pGMAP000467
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PSMD10/dJ889N15.2/p28 adenoviral expression plasmid for PSMD10 adenovirus packaging, PSMD10 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.


Target products collection

Go to PSMD10/dJ889N15.2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAP000467
Gene Name PSMD10
Accession Number BC011960
Gene ID 5716
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 681 bp
Gene Alias dJ889N15.2,p28
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGGGGTGTGTGTCTAACCTAATGGTCTGCAACCTGGCCTACAGCGGGAAGCTGGAAGAGTTGAAGGAGAGTATTCTGGCCGATAAATCCCTGGCTACTAGAACTGACCAGGACAGCAGAACTGCATTGCACTGGGCATGCTCAGCTGGACATACAGAAATTGTTGAATTTTTGTTGCAACTTGGAGTGCCAGTGAATGATAAAGACGATGCAGGTTGGTCTCCTCTTCATATTGCGGCTTCTGCTGGCCGGGATGAGATTGTAAAAGCCCTTCTGGGAAAAGGTGCTCAAGTGAATGCTGTCAATCAAAATGGCTGTACTCCCTTACATTATGCAGCTTCGAAAAACAGGCATGAGATCGCTGTCATGTTACTGGAAGGCGGGGCTAATCCAGATGCTAAGGACCATTATGAGGCTACAGCAATGCACCGGGCAGCAGCCAAGGGTAACTTGAAGATGATTCATATCCTTCTGTACTACAAAGCATCCACAAACATCCAAGACACTGAGGGTAACACTCCTCTACACTTAGCCTGTGATGAGGAGAGAGTGGAAGAAGCAAAACTGCTGGTGTCCCAAGGAGCAAGTATTTACATTGAGAATAAAGAAGAAAAGACACCCCTGCAAGTGGCCAAAGGTGGCCTGGGTTTAATACTCAAGAGAATGGTGGAAGGTTAA
ORF Protein Sequence MEGCVSNLMVCNLAYSGKLEELKESILADKSLATRTDQDSRTALHWACSAGHTEIVEFLLQLGVPVNDKDDAGWSPLHIAASAGRDEIVKALLGKGAQVNAVNQNGCTPLHYAASKNRHEIAVMLLEGGANPDAKDHYEATAMHRAAAKGNLKMIHILLYYKASTNIQDTEGNTPLHLACDEERVEEAKLLVSQGASIYIENKEEKTPLQVAKGGLGLILKRMVEG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T53890-Ab Anti-PSMD10 monoclonal antibody
    Target Antigen GM-Tg-g-T53890-Ag PSMD10 protein
    ORF Viral Vector pGMLP000500 Human PSMD10 Lentivirus plasmid
    ORF Viral Vector pGMAP000467 Human PSMD10 Adenovirus plasmid
    ORF Viral Vector vGMLP000500 Human PSMD10 Lentivirus particle
    ORF Viral Vector vGMAP000467 Human PSMD10 Adenovirus particle


    Target information

    Target ID GM-T53890
    Target Name PSMD10
    Gene ID 5716, 53380, 703596, 116722, 101087906, 481014, 535414, 100054590
    Gene Symbol and Synonyms dJ889N15.2,p28,p28(GANK),p28Gank,PSMD10
    Uniprot Accession O75832
    Uniprot Entry Name PSD10_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000101843
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a subunit of the PA700/19S complex, which is the regulatory component of the 26S proteasome. The 26S proteosome complex is required for ubiquitin-dependent protein degradation. This protein is a non-ATPase subunit that may be involved in protein-protein interactions. Aberrant expression of this gene may paly a role in tumorigenesis. Two transcripts encoding different isoforms have been described. Pseudogenes have been identified on chromosomes 3 and 20.[provided by RefSeq, Mar 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.