Human PSMD10/dJ889N15.2/ p28 ORF/cDNA clone-Adenovirus particle (BC011960)
Pre-made Human PSMD10/dJ889N15.2/ p28 Adenovirus for PSMD10 overexpression in-vitro and in-vivo. The PSMD10 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified PSMD10-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to PSMD10/dJ889N15.2 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000467 | Human PSMD10 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000467 |
Gene Name | PSMD10 |
Accession Number | BC011960 |
Gene ID | 5716 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 681 bp |
Gene Alias | dJ889N15.2, p28 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGAGGGGTGTGTGTCTAACCTAATGGTCTGCAACCTGGCCTACAGCGGGAAGCTGGAAGAGTTGAAGGAGAGTATTCTGGCCGATAAATCCCTGGCTACTAGAACTGACCAGGACAGCAGAACTGCATTGCACTGGGCATGCTCAGCTGGACATACAGAAATTGTTGAATTTTTGTTGCAACTTGGAGTGCCAGTGAATGATAAAGACGATGCAGGTTGGTCTCCTCTTCATATTGCGGCTTCTGCTGGCCGGGATGAGATTGTAAAAGCCCTTCTGGGAAAAGGTGCTCAAGTGAATGCTGTCAATCAAAATGGCTGTACTCCCTTACATTATGCAGCTTCGAAAAACAGGCATGAGATCGCTGTCATGTTACTGGAAGGCGGGGCTAATCCAGATGCTAAGGACCATTATGAGGCTACAGCAATGCACCGGGCAGCAGCCAAGGGTAACTTGAAGATGATTCATATCCTTCTGTACTACAAAGCATCCACAAACATCCAAGACACTGAGGGTAACACTCCTCTACACTTAGCCTGTGATGAGGAGAGAGTGGAAGAAGCAAAACTGCTGGTGTCCCAAGGAGCAAGTATTTACATTGAGAATAAAGAAGAAAAGACACCCCTGCAAGTGGCCAAAGGTGGCCTGGGTTTAATACTCAAGAGAATGGTGGAAGGTTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T53890-Ab | Anti-PSMD10 monoclonal antibody |
Target Antigen | GM-Tg-g-T53890-Ag | PSMD10 protein |
ORF Viral Vector | pGMLP000500 | Human PSMD10 Lentivirus plasmid |
ORF Viral Vector | pGMAP000467 | Human PSMD10 Adenovirus plasmid |
ORF Viral Vector | vGMLP000500 | Human PSMD10 Lentivirus particle |
ORF Viral Vector | vGMAP000467 | Human PSMD10 Adenovirus particle |
Target information
Target ID | GM-T53890 |
Target Name | PSMD10 |
Gene ID | 5716, 53380, 703596, 116722, 101087906, 481014, 535414, 100054590 |
Gene Symbol and Synonyms | dJ889N15.2,p28,p28(GANK),p28Gank,PSMD10 |
Uniprot Accession | O75832 |
Uniprot Entry Name | PSD10_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000101843 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a subunit of the PA700/19S complex, which is the regulatory component of the 26S proteasome. The 26S proteosome complex is required for ubiquitin-dependent protein degradation. This protein is a non-ATPase subunit that may be involved in protein-protein interactions. Aberrant expression of this gene may paly a role in tumorigenesis. Two transcripts encoding different isoforms have been described. Pseudogenes have been identified on chromosomes 3 and 20.[provided by RefSeq, Mar 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.