Human CD79A/MB-1 ORF/cDNA clone-Adenovirus plasmid (BC113731)
Pre-made Human CD79A/MB-1 adenoviral expression plasmid for CD79A adenovirus packaging, CD79A adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to CD79A/MB-1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAP000491 | Human CD79A Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAP000491 |
Gene Name | CD79A |
Accession Number | BC113731 |
Gene ID | 973 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 681 bp |
Gene Alias | MB-1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCCTGGGGGTCCAGGAGTCCTCCAAGCTCTGCCTGCCACCATCTTCCTCCTCTTCCTGCTGTCTGCTGTCTACCTGGGCCCTGGGTGCCAGGCCCTGTGGATGCACAAGGTCCCAGCATCATTGATGGTGAGCCTGGGGGAAGACGCCCACTTCCAATGCCCGCACAATAGCAGCAACAACGCCAACGTCACCTGGTGGCGCGTCCTCCATGGCAACTACACGTGGCCCCCTGAGTTCTTGGGCCCGGGCGAGGACCCCAATGGTACGCTGATCATCCAGAATGTGAACAAGAGCCATGGGGGCATATACGTGTGCCGGGTCCAGGAGGGCAACGAGTCATACCAGCAGTCCTGCGGCACCTACCTCCGCGTGCGCCAGCCGCCCCCCAGGCCCTTCCTGGACATGGGGGAGGGCACCAAGAACCGAATCATCACAGCCGAGGGGATCATCCTCCTGTTCTGCGCGGTGGTGCCTGGGACGCTGCTGCTGTTCAGGAAACGATGGCAGAACGAGAAGCTCGGGTTGGATGCCGGGGATGAATATGAAGATGAAAACCTTTATGAAGGCCTGAACCTGGACGACTGCTCCATGTATGAGGACATCTCCCGGGGCCTCCAGGGCACCTACCAGGATGTGGGCAGCCTCAACATAGGAGATGTCCAGCTGGAGAAGCCGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP0216-Ab | Anti-CD79A/ IGA/ MB-1 monoclonal antibody |
Target Antigen | GM-Tg-g-MP0216-Ag | CD79A VLP (virus-like particle) |
ORF Viral Vector | pGMAP000491 | Human CD79A Adenovirus plasmid |
ORF Viral Vector | vGMAP000491 | Human CD79A Adenovirus particle |
Target information
Target ID | GM-MP0216 |
Target Name | CD79A |
Gene ID | 973, 12518, 722190, 100913063, 101083127, 484483, 281674, 100052219 |
Gene Symbol and Synonyms | CD79A,Cd79al,Ig-alpha,IGA,IGAlpha,Ly-54,Ly54,MB-1,MB1 |
Uniprot Accession | P11912 |
Uniprot Entry Name | CD79A_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Cancer |
Gene Ensembl | ENSG00000105369 |
Target Classification | Tumor-associated antigen (TAA) |
The B lymphocyte antigen receptor is a multimeric complex that includes the antigen-specific component, surface immunoglobulin (Ig). Surface Ig non-covalently associates with two other proteins, Ig-alpha and Ig-beta, which are necessary for expression and function of the B-cell antigen receptor. This gene encodes the Ig-alpha protein of the B-cell antigen component. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.