Human CD79A/MB-1 ORF/cDNA clone-Adenovirus plasmid (BC113731)

Pre-made Human CD79A/MB-1 adenoviral expression plasmid for CD79A adenovirus packaging, CD79A adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to CD79A/MB-1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP000491 Human CD79A Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP000491
Gene Name CD79A
Accession Number BC113731
Gene ID 973
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 681 bp
Gene Alias MB-1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCCTGGGGGTCCAGGAGTCCTCCAAGCTCTGCCTGCCACCATCTTCCTCCTCTTCCTGCTGTCTGCTGTCTACCTGGGCCCTGGGTGCCAGGCCCTGTGGATGCACAAGGTCCCAGCATCATTGATGGTGAGCCTGGGGGAAGACGCCCACTTCCAATGCCCGCACAATAGCAGCAACAACGCCAACGTCACCTGGTGGCGCGTCCTCCATGGCAACTACACGTGGCCCCCTGAGTTCTTGGGCCCGGGCGAGGACCCCAATGGTACGCTGATCATCCAGAATGTGAACAAGAGCCATGGGGGCATATACGTGTGCCGGGTCCAGGAGGGCAACGAGTCATACCAGCAGTCCTGCGGCACCTACCTCCGCGTGCGCCAGCCGCCCCCCAGGCCCTTCCTGGACATGGGGGAGGGCACCAAGAACCGAATCATCACAGCCGAGGGGATCATCCTCCTGTTCTGCGCGGTGGTGCCTGGGACGCTGCTGCTGTTCAGGAAACGATGGCAGAACGAGAAGCTCGGGTTGGATGCCGGGGATGAATATGAAGATGAAAACCTTTATGAAGGCCTGAACCTGGACGACTGCTCCATGTATGAGGACATCTCCCGGGGCCTCCAGGGCACCTACCAGGATGTGGGCAGCCTCAACATAGGAGATGTCCAGCTGGAGAAGCCGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0216-Ab Anti-CD79A/ IGA/ MB-1 monoclonal antibody
    Target Antigen GM-Tg-g-MP0216-Ag CD79A VLP (virus-like particle)
    ORF Viral Vector pGMAP000491 Human CD79A Adenovirus plasmid
    ORF Viral Vector vGMAP000491 Human CD79A Adenovirus particle


    Target information

    Target ID GM-MP0216
    Target Name CD79A
    Gene ID 973, 12518, 722190, 100913063, 101083127, 484483, 281674, 100052219
    Gene Symbol and Synonyms CD79A,Cd79al,Ig-alpha,IGA,IGAlpha,Ly-54,Ly54,MB-1,MB1
    Uniprot Accession P11912
    Uniprot Entry Name CD79A_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000105369
    Target Classification Tumor-associated antigen (TAA)

    The B lymphocyte antigen receptor is a multimeric complex that includes the antigen-specific component, surface immunoglobulin (Ig). Surface Ig non-covalently associates with two other proteins, Ig-alpha and Ig-beta, which are necessary for expression and function of the B-cell antigen receptor. This gene encodes the Ig-alpha protein of the B-cell antigen component. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.