Human ANGPT2/AGPT2/ ANG2 ORF/cDNA clone-Adenovirus plasmid (BC126200)

Pre-made Human ANGPT2/AGPT2/ ANG2 adenoviral expression plasmid for ANGPT2 adenovirus packaging, ANGPT2 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to ANGPT2/AGPT2 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP000494 Human ANGPT2 Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP000494
Gene Name ANGPT2
Accession Number BC126200
Gene ID 285
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 1491 bp
Gene Alias AGPT2, ANG2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTGGCAGATTGTTTTCTTTACTCTGAGCTGTGATCTTGTCTTGGCCGCAGCCTATAACAACTTTCGGAAGAGCATGGACAGCATAGGAAAGAAGCAATATCAGGTCCAGCATGGGTCCTGCAGCTACACTTTCCTCCTGCCAGAGATGGACAACTGCCGCTCTTCCTCCAGCCCCTACGTGTCCAATGCTGTGCAGAGGGACGCGCCGCTCGAATACGATGACTCGGTGCAGAGGCTGCAAGTGCTGGAGAACATCATGGAAAACAACACTCAGTGGCTAATGAAGCTTGAGAATTATATCCAGGACAACATGAAGAAAGAAATGGTAGAGATACAGCAGAATGCAGTACAGAACCAGACGGCTGTGATGATAGAAATAGGGACAAACCTGTTGAACCAAACAGCGGAGCAAACGCGGAAGTTAACTGATGTGGAAGCCCAAGTATTAAATCAGACCACGAGACTTGAACTTCAGCTCTTGGAACACTCCCTCTCGACAAACAAATTGGAAAAACAGATTTTGGACCAGACCAGTGAAATAAACAAATTGCAAGATAAGAACAGTTTCCTAGAAAAGAAGGTGCTAGCTATGGAAGACAAGCACATCATCCAACTACAGTCAATAAAAGAAGAGAAAGATCAGCTACAGGTGTTAGTATCCAAGCAAAATTCCATCATTGAAGAACTAGAAAAAAAAATAGTGACTGCCACGGTGAATAATTCAGTTCTTCAAAAGCAGCAACATGATCTCATGGAGACAGTTAATAACTTACTGACTATGATGTCCACATCAAACTCAGCTAAGGACCCCACTGTTGCTAAAGAAGAACAAATCAGCTTCAGAGACTGTGCTGAAGTATTCAAATCAGGACACACCACGAATGGCATCTACACGTTAACATTCCCTAATTCTACAGAAGAGATCAAGGCCTACTGTGACATGGAAGCTGGAGGAGGCGGGTGGACAATTATTCAGCGACGTGAGGATGGCAGCGTTGATTTTCAGAGGACTTGGAAAGAATATAAAGTGGGATTTGGTAACCCTTCAGGAGAATATTGGCTGGGAAATGAGTTTGTTTCGCAACTGACTAATCAGCAACGCTACGTGCTTAAAATACACCTTAAAGACTGGGAAGGGAATGAGGCTTACTCATTGTATGAACATTTCTATCTCTCAAGTGAAGAACTCAATTATAGGATTCACCTTAAAGGACTTACAGGGACAGCCGGCAAAATAAGCAGCATCAGCCAACCAGGAAATGATTTTAGCACAAAGGATGGAGACAACGACAAATGTATTTGCAAATGTTCACAAATGCTAACAGGAGGCTGGTGGTTTGATGCATGTGGTCCTTCCAACTTGAACGGAATGTACTATCCACAGAGGCAGAACACAAATAAGTTCAACGGCATTAAATGGTACTACTGGAAAGGCTCAGGCTATTCGCTCAAGGCCACAACCATGATGATCCGACCAGCAGATTTCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-373 Pre-Made Nesvacumab biosimilar, Whole mAb, Anti-ANGPT2 Antibody: Anti-AGPT2/ANG2/LMPHM10 therapeutic antibody
    Biosimilar GMP-Bios-ab-612 Pre-Made Vanucizumab biosimilar, Bispecific mAb, Anti-ANGPT2;VEGFA Antibody: Anti-AGPT2/ANG2/LMPHM10;VPF/VEGF/MVCD1 therapeutic antibody
    Biosimilar GMP-Bios-ab-641 Pre-Made Zansecimab biosimilar, Whole mAb, Anti-ANGPT2 Antibody: Anti-AGPT2/ANG2/LMPHM10 therapeutic antibody
    Biosimilar GMP-Bios-ab-204 Pre-Made Faricimab biosimilar, Bispecific mAb, Anti-VEGFA;ANGPT2 Antibody: Anti-VPF/VEGF/MVCD1;AGPT2/ANG2/LMPHM10 therapeutic antibody
    Biosimilar GMP-Bios-INN-1034 Pre-Made Trebananib Biosimilar, Fusion Protein targeting ANGPT2 fused with human IGHG1 Fc (Fragment constant): Recombinant therapeutic protein targeting AGPT2/ANG2/LMPHM10
    Target Antibody GM-Tg-g-T21960-Ab Anti-ANGP2/ ANGPT2/ AGPT2 monoclonal antibody
    Target Antigen GM-Tg-g-T21960-Ag ANGPT2 VLP (virus-like particle)
    ORF Viral Vector pGMLV001516 Human ANGPT2 Lentivirus plasmid
    ORF Viral Vector pGMPC001157 Human ANGPT2 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMAP000494 Human ANGPT2 Adenovirus plasmid
    ORF Viral Vector vGMLV001516 Human ANGPT2 Lentivirus particle
    ORF Viral Vector vGMAP000494 Human ANGPT2 Adenovirus particle
    ORF Viral Vector pGMLV002094 Human ANGPT2 Lentivirus plasmid


    Target information

    Target ID GM-T21960
    Target Name ANGPT2
    Gene ID 285, 11601, 716811, 89805, 102901787, 607616, 282141, 100051890
    Gene Symbol and Synonyms AGPT2,Ang-2,ANG2,ANGPT2,LMPHM10
    Uniprot Accession O15123
    Uniprot Entry Name ANGP2_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease breast cancer
    Gene Ensembl ENSG00000091879
    Target Classification Checkpoint-Immuno Oncology

    This gene belongs to the angiopoietin family of growth factors. The protein encoded by this gene is an antagonist of angiopoietin 1, and both angiopoietin 1 and angiopoietin 2 are ligands for the endothelial TEK receptor tyrosine kinase. Angiopoietin 2 is upregulated in multiple inflammatory diseases and is implicated in the direct control of inflammation-related signaling pathways. The encoded protein affects angiogenesis during embryogenesis and tumorigenesis, disrupts the vascular remodeling ability of angiopoietin 1, and may induce endothelial cell apoptosis. This gene serves a prognostic biomarker for acute respiratory distress syndrome. [provided by RefSeq, Aug 2020]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.