Human RNASEH2C/AGS3/ AYP1 ORF/cDNA clone-Adenovirus plasmid (BC023588)
Pre-made Human RNASEH2C/AGS3/ AYP1 adenoviral expression plasmid for RNASEH2C adenovirus packaging, RNASEH2C adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to RNASEH2C/AGS3 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAP000510 | Human RNASEH2C Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAP000510 |
Gene Name | RNASEH2C |
Accession Number | BC023588 |
Gene ID | 84153 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 495 bp |
Gene Alias | AGS3, AYP1, FLJ20974, MGC22934 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGAGAGCGGCGACGAAGCGGCCATCGAGAGGCACCGCGTCCACTTGCGCTCCGCCACATTGCGCGACGCCGTACCCGCCACACTGCATCTGCTGCCCTGCGAGGTTGCGGTGGACGGGCCCGCCCCGGTGGGGCGCTTCTTCACGCCCGCCATCCGCCAGGGCCCCGAGGGACTCGAAGTGTCGTTTCGGGGCCGCTGTCTACGGGGAGAGGAGGTGGCGGTGCCGCCTGGCCTCGTGGGATACGTGATGGTGACAGAAGAGAAGAAGGTGTCGATGGGGAAGCCAGACCCCTTGCGGGATTCCGGGACTGACGACCAAGAGGAGGAGCCGCTGGAGCGGGACTTCGACCGCTTCATTGGAGCCACTGCCAACTTCAGCCGCTTCACCCTGTGGGGTCTGGAGACCATCCCTGGCCCGGATGCCAAAGTGCGTGGGGCCTTAACTTGGCCCAGCCTTGCGGCAGCGATTCACGCACAGGTGCCCGAGGACTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-TA154-Ab | Anti-RNASEH2C monoclonal antibody |
Target Antigen | GM-Tg-g-TA154-Ag | RNASEH2C protein |
ORF Viral Vector | pGMAP000510 | Human RNASEH2C Adenovirus plasmid |
ORF Viral Vector | vGMAP000510 | Human RNASEH2C Adenovirus particle |
Target information
Target ID | GM-TA154 |
Target Name | RNASEH2C |
Gene ID | 84153, 68209, 700330, 100361939, 101100003, 610886, 505618, 100057522 |
Gene Symbol and Synonyms | 1500026D16Rik,AGS3,AYP1,RNASEH2C |
Uniprot Accession | Q8TDP1 |
Uniprot Entry Name | RNH2C_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000172922 |
Target Classification | Not Available |
This gene encodes a ribonuclease H subunit that can cleave ribonucleotides from RNA:DNA duplexes. Mutations in this gene cause Aicardi-Goutieres syndrome-3, a disease that causes severe neurologic dysfunction. A pseudogene for this gene has been identified on chromosome Y, near the sex determining region Y (SRY) gene. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.