Human RNASEH2C/AGS3/ AYP1 ORF/cDNA clone-Adenovirus plasmid (BC023588)

Pre-made Human RNASEH2C/AGS3/ AYP1 adenoviral expression plasmid for RNASEH2C adenovirus packaging, RNASEH2C adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to RNASEH2C/AGS3 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP000510 Human RNASEH2C Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP000510
Gene Name RNASEH2C
Accession Number BC023588
Gene ID 84153
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 495 bp
Gene Alias AGS3, AYP1, FLJ20974, MGC22934
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAGAGCGGCGACGAAGCGGCCATCGAGAGGCACCGCGTCCACTTGCGCTCCGCCACATTGCGCGACGCCGTACCCGCCACACTGCATCTGCTGCCCTGCGAGGTTGCGGTGGACGGGCCCGCCCCGGTGGGGCGCTTCTTCACGCCCGCCATCCGCCAGGGCCCCGAGGGACTCGAAGTGTCGTTTCGGGGCCGCTGTCTACGGGGAGAGGAGGTGGCGGTGCCGCCTGGCCTCGTGGGATACGTGATGGTGACAGAAGAGAAGAAGGTGTCGATGGGGAAGCCAGACCCCTTGCGGGATTCCGGGACTGACGACCAAGAGGAGGAGCCGCTGGAGCGGGACTTCGACCGCTTCATTGGAGCCACTGCCAACTTCAGCCGCTTCACCCTGTGGGGTCTGGAGACCATCCCTGGCCCGGATGCCAAAGTGCGTGGGGCCTTAACTTGGCCCAGCCTTGCGGCAGCGATTCACGCACAGGTGCCCGAGGACTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-TA154-Ab Anti-RNASEH2C monoclonal antibody
    Target Antigen GM-Tg-g-TA154-Ag RNASEH2C protein
    ORF Viral Vector pGMAP000510 Human RNASEH2C Adenovirus plasmid
    ORF Viral Vector vGMAP000510 Human RNASEH2C Adenovirus particle


    Target information

    Target ID GM-TA154
    Target Name RNASEH2C
    Gene ID 84153, 68209, 700330, 100361939, 101100003, 610886, 505618, 100057522
    Gene Symbol and Synonyms 1500026D16Rik,AGS3,AYP1,RNASEH2C
    Uniprot Accession Q8TDP1
    Uniprot Entry Name RNH2C_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000172922
    Target Classification Not Available

    This gene encodes a ribonuclease H subunit that can cleave ribonucleotides from RNA:DNA duplexes. Mutations in this gene cause Aicardi-Goutieres syndrome-3, a disease that causes severe neurologic dysfunction. A pseudogene for this gene has been identified on chromosome Y, near the sex determining region Y (SRY) gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.