Human HNRNPA2B1/HNRNPA2/ HNRNPB1 ORF/cDNA clone-Adenovirus plasmid (BC000506)

Pre-made Human HNRNPA2B1/HNRNPA2/ HNRNPB1 adenoviral expression plasmid for HNRNPA2B1 adenovirus packaging, HNRNPA2B1 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to HNRNPA2B1/HNRNPA2 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP000544 Human HNRNPA2B1 Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP000544
Gene Name HNRNPA2B1
Accession Number BC000506
Gene ID 3181
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 750 bp
Gene Alias HNRNPA2, HNRNPB1, HNRPA2, HNRPB1, RNPA2, SNRPB1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAGAGAGAAAAGGAACAGTTCCGTAAGCTCTTTATTGGTGGCTTAAGCTTTGAAACCACAGAAGAAAGTTTGAGGAACTACTACGAACAATGGGGAAAGCTTACAGACTGTGTGGTAATGAGGGATCCTGCAAGCAAAAGATCAAGAGGATTTGGTTTTGTAACTTTTTCATCCATGGCTGAGGTTGATGCTGCCATGGCTGCAAGACCTCATTCAATTGATGGGAGAGTAGTTGAGCCAAAACGTGCTGTAGCAAGAGAGGAATCTGGAAAACCAGGGGCTCATGTAACTGTGAAGAAGCTGTTTGTTGGCGGAATTAAAGAAGATACTGAGGAACATCACCTTAGAGATTACTTTGAGGAATATGGAAAAATTGATACCATTGAGATAATTACTGATAGGCAGTCTGGAAAGAAAAGAGGCTTTGGCTTTGTTACTTTTGATGACCATGATCCTGTGGATAAAATCGTATTGCAGAAATACCATACCATCAATGGTCATAATGCAGAAGTAAGAAAGGCTTTGTCTAGACAAGAAATGCAGGAGGACCTGGAGGTGGCAATTTTGGAGGTAGCCCCGGTTATGGAGGAGGAAGAGGAGGATATGGTGGTGGAGGACCTGGATATGGCAACCAGGGTGGGGGCTACGGAGGTGGTTATGACAACTATGGAGGAGGAAATTATGGAAGTGGAAATTACAATGATTTTGGAAATTATAACCAGCAACCTTCTAACTACGGTCCAATGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1481-Ab Anti-ROA2/ HNRNPA2B1/ HNRNPA2 functional antibody
    Target Antigen GM-Tg-g-SE1481-Ag HNRNPA2B1 protein
    ORF Viral Vector pGMLV000301 Human HNRNPA2B1 Lentivirus plasmid
    ORF Viral Vector pGMAP000544 Human HNRNPA2B1 Adenovirus plasmid
    ORF Viral Vector vGMLV000301 Human HNRNPA2B1 Lentivirus particle
    ORF Viral Vector vGMAP000544 Human HNRNPA2B1 Adenovirus particle


    Target information

    Target ID GM-SE1481
    Target Name HNRNPA2B1
    Gene ID 3181, 53379, 701821, 362361, 101098942, 475260, 507564, 100068539
    Gene Symbol and Synonyms 9130414A06Rik,hnRNP,hnrnp-A,HNRNPA2,HNRNPA2B1,HNRNPB1,HNRPA2,HNRPA2B1,HNRPB1,IBMPFD2,RNPA2,SNRPB1
    Uniprot Accession P22626
    Uniprot Entry Name ROA2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000122566
    Target Classification Tumor-associated antigen (TAA)

    This gene belongs to the A/B subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has two repeats of quasi-RRM domains that bind to RNAs. This gene has been described to generate two alternatively spliced transcript variants which encode different isoforms. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.