Human HNRNPA2B1/HNRNPA2/ HNRNPB1 ORF/cDNA clone-Adenovirus plasmid (BC000506)
Pre-made Human HNRNPA2B1/HNRNPA2/ HNRNPB1 adenoviral expression plasmid for HNRNPA2B1 adenovirus packaging, HNRNPA2B1 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to HNRNPA2B1/HNRNPA2 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAP000544 | Human HNRNPA2B1 Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAP000544 |
Gene Name | HNRNPA2B1 |
Accession Number | BC000506 |
Gene ID | 3181 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 750 bp |
Gene Alias | HNRNPA2, HNRNPB1, HNRPA2, HNRPB1, RNPA2, SNRPB1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGAGAGAGAAAAGGAACAGTTCCGTAAGCTCTTTATTGGTGGCTTAAGCTTTGAAACCACAGAAGAAAGTTTGAGGAACTACTACGAACAATGGGGAAAGCTTACAGACTGTGTGGTAATGAGGGATCCTGCAAGCAAAAGATCAAGAGGATTTGGTTTTGTAACTTTTTCATCCATGGCTGAGGTTGATGCTGCCATGGCTGCAAGACCTCATTCAATTGATGGGAGAGTAGTTGAGCCAAAACGTGCTGTAGCAAGAGAGGAATCTGGAAAACCAGGGGCTCATGTAACTGTGAAGAAGCTGTTTGTTGGCGGAATTAAAGAAGATACTGAGGAACATCACCTTAGAGATTACTTTGAGGAATATGGAAAAATTGATACCATTGAGATAATTACTGATAGGCAGTCTGGAAAGAAAAGAGGCTTTGGCTTTGTTACTTTTGATGACCATGATCCTGTGGATAAAATCGTATTGCAGAAATACCATACCATCAATGGTCATAATGCAGAAGTAAGAAAGGCTTTGTCTAGACAAGAAATGCAGGAGGACCTGGAGGTGGCAATTTTGGAGGTAGCCCCGGTTATGGAGGAGGAAGAGGAGGATATGGTGGTGGAGGACCTGGATATGGCAACCAGGGTGGGGGCTACGGAGGTGGTTATGACAACTATGGAGGAGGAAATTATGGAAGTGGAAATTACAATGATTTTGGAAATTATAACCAGCAACCTTCTAACTACGGTCCAATGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE1481-Ab | Anti-ROA2/ HNRNPA2B1/ HNRNPA2 functional antibody |
Target Antigen | GM-Tg-g-SE1481-Ag | HNRNPA2B1 protein |
ORF Viral Vector | pGMLV000301 | Human HNRNPA2B1 Lentivirus plasmid |
ORF Viral Vector | pGMAP000544 | Human HNRNPA2B1 Adenovirus plasmid |
ORF Viral Vector | vGMLV000301 | Human HNRNPA2B1 Lentivirus particle |
ORF Viral Vector | vGMAP000544 | Human HNRNPA2B1 Adenovirus particle |
Target information
Target ID | GM-SE1481 |
Target Name | HNRNPA2B1 |
Gene ID | 3181, 53379, 701821, 362361, 101098942, 475260, 507564, 100068539 |
Gene Symbol and Synonyms | 9130414A06Rik,hnRNP,hnrnp-A,HNRNPA2,HNRNPA2B1,HNRNPB1,HNRPA2,HNRPA2B1,HNRPB1,IBMPFD2,RNPA2,SNRPB1 |
Uniprot Accession | P22626 |
Uniprot Entry Name | ROA2_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Cancer |
Gene Ensembl | ENSG00000122566 |
Target Classification | Tumor-associated antigen (TAA) |
This gene belongs to the A/B subfamily of ubiquitously expressed heterogeneous nuclear ribonucleoproteins (hnRNPs). The hnRNPs are RNA binding proteins and they complex with heterogeneous nuclear RNA (hnRNA). These proteins are associated with pre-mRNAs in the nucleus and appear to influence pre-mRNA processing and other aspects of mRNA metabolism and transport. While all of the hnRNPs are present in the nucleus, some seem to shuttle between the nucleus and the cytoplasm. The hnRNP proteins have distinct nucleic acid binding properties. The protein encoded by this gene has two repeats of quasi-RRM domains that bind to RNAs. This gene has been described to generate two alternatively spliced transcript variants which encode different isoforms. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.