Human CD200/MOX1/ MOX2 ORF/cDNA clone-Adenovirus plasmid (NM_005944.6)

Pre-made Human CD200/MOX1/ MOX2 adenoviral expression plasmid for CD200 adenovirus packaging, CD200 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to CD200/MOX1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP000585 Human CD200 Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP000585
Gene Name CD200
Accession Number NM_005944.6
Gene ID 4345
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 810 bp
Gene Alias MOX1, MOX2, MRC, OX-2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAGAGGCTGGTGATCAGGATGCCCTTCTCTCATCTGTCTACCTACAGCCTGGTTTGGGTCATGGCAGCAGTGGTGCTGTGCACAGCACAAGTGCAAGTGGTGACCCAGGATGAAAGAGAGCAGCTGTACACACCTGCTTCCTTAAAATGCTCTCTGCAAAATGCCCAGGAAGCCCTCATTGTGACATGGCAGAAAAAGAAAGCTGTAAGCCCAGAAAACATGGTCACCTTCAGCGAGAACCATGGGGTGGTGATCCAGCCTGCCTATAAGGACAAGATAAACATTACCCAGCTGGGACTCCAAAACTCAACCATCACCTTCTGGAATATCACCCTGGAGGATGAAGGGTGTTACATGTGTCTCTTCAATACCTTTGGTTTTGGGAAGATCTCAGGAACGGCCTGCCTCACCGTCTATGTACAGCCCATAGTATCCCTTCACTACAAATTCTCTGAAGACCACCTAAATATCACTTGCTCTGCCACTGCCCGCCCAGCCCCCATGGTCTTCTGGAAGGTCCCTCGGTCAGGGATTGAAAATAGTACAGTGACTCTGTCTCACCCAAATGGGACCACGTCTGTTACCAGCATCCTCCATATCAAAGACCCTAAGAATCAGGTGGGGAAGGAGGTGATCTGCCAGGTGCTGCACCTGGGGACTGTGACCGACTTTAAGCAAACCGTCAACAAAGGCTATTGGTTTTCAGTTCCGCTATTGCTAAGCATTGTTTCCCTGGTAATTCTTCTCGTCCTAATCTCAATCTTACTGTACTGGAAACGTCACCGGAATCAGGACCGAGAGCCCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-504 Pre-Made Samalizumab biosimilar, Whole mAb, Anti-CD200 Antibody: Anti-MRC/MOX1/MOX2/OX-2 therapeutic antibody
    Target Antibody GM-Tg-g-T81695-Ab Anti-OX2G/ CD200/ MOX1 monoclonal antibody
    Target Antigen GM-Tg-g-T81695-Ag CD200 VLP (virus-like particle)
    ORF Viral Vector pGMLV000200 Human CD200 Lentivirus plasmid
    ORF Viral Vector pGMAP000585 Human CD200 Adenovirus plasmid
    ORF Viral Vector vGMLV000200 Human CD200 Lentivirus particle
    ORF Viral Vector vGMAP000585 Human CD200 Adenovirus particle


    Target information

    Target ID GM-T81695
    Target Name CD200
    Gene ID 4345, 17470, 708110, 24560, 101096094, 607499, 534910
    Gene Symbol and Synonyms CD200,Cspmo2,MOX1,MOX2,MRC,MRCOX2,OX-2,OX2
    Uniprot Accession P41217
    Uniprot Entry Name OX2G_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease Cancer
    Gene Ensembl ENSG00000091972
    Target Classification Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA)

    This gene encodes a type I membrane glycoprotein containing two extracellular immunoglobulin domains, a transmembrane and a cytoplasmic domain. This gene is expressed by various cell types, including B cells, a subset of T cells, thymocytes, endothelial cells, and neurons. The encoded protein plays an important role in immunosuppression and regulation of anti-tumor activity. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.