Human IGF2/C11orf43/GRDF ORF/cDNA clone-Lentivirus plasmid (NM_001127598.2)
Cat. No.: pGMLV000393
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human IGF2/C11orf43/GRDF Lentiviral expression plasmid for IGF2 lentivirus packaging, IGF2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
IGF2/C11orf43 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMLV000393 |
| Gene Name | IGF2 |
| Accession Number | NM_001127598.2 |
| Gene ID | 3481 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 711 bp |
| Gene Alias | C11orf43,GRDF,IGF-II,PP9974 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGTTTCCCCAGACCCCCAAATTATCGTGGTGGCCCCCGAGACCGAACTCGCGTCTATGCAAGTCCAACGCACTGAGGACGGGGTAACCATTATCCAGATATTTTGGGTGGGCCGCAAAGGCGAGCTACTTAGACGCACCCCGGTGAGCTCGGCCATGCAGACACCAATGGGAATCCCAATGGGGAAGTCGATGCTGGTGCTTCTCACCTTCTTGGCCTTCGCCTCGTGCTGCATTGCTGCTTACCGCCCCAGTGAGACCCTGTGCGGCGGGGAGCTGGTGGACACCCTCCAGTTCGTCTGTGGGGACCGCGGCTTCTACTTCAGCAGGCCCGCAAGCCGTGTGAGCCGTCGCAGCCGTGGCATCGTTGAGGAGTGCTGTTTCCGCAGCTGTGACCTGGCCCTCCTGGAGACGTACTGTGCTACCCCCGCCAAGTCCGAGAGGGACGTGTCGACCCCTCCGACCGTGCTTCCGGACAACTTCCCCAGATACCCCGTGGGCAAGTTCTTCCAATATGACACCTGGAAGCAGTCCACCCAGCGCCTGCGCAGGGGCCTGCCTGCCCTCCTGCGTGCCCGCCGGGGTCACGTGCTCGCCAAGGAGCTCGAGGCGTTCAGGGAGGCCAAACGTCACCGTCCCCTGATTGCTCTACCCACCCAAGACCCCGCCCACGGGGGCGCCCCCCCAGAGATGGCCAGCAATCGGAAGTGA |
| ORF Protein Sequence | MVSPDPQIIVVAPETELASMQVQRTEDGVTIIQIFWVGRKGELLRRTPVSSAMQTPMGIPMGKSMLVLLTFLAFASCCIAAYRPSETLCGGELVDTLQFVCGDRGFYFSRPASRVSRRSRGIVEECCFRSCDLALLETYCATPAKSERDVSTPPTVLPDNFPRYPVGKFFQYDTWKQSTQRLRRGLPALLRARRGHVLAKELEAFREAKRHRPLIALPTQDPAHGGAPPEMASNRK |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Biosimilar | GMP-Bios-ab-634 | Pre-Made Xentuzumab biosimilar, Whole mAb, Anti-IGF1;IGF2 Antibody: Anti-IGF/IGF-I/IGFI/MGF;C11orf43/GRDF/IGF-II/PP9974/SRS3 therapeutic antibody |
| Biosimilar | GMP-Bios-ab-160 | Pre-Made Dusigitumab biosimilar, Whole mAb, Anti-IGF1;IGF2 Antibody: Anti-IGF/IGF-I/IGFI/MGF;C11orf43/GRDF/IGF-II/PP9974/SRS3 therapeutic antibody |
| Target Antibody | GM-Tg-g-T90572-Ab | Anti-IGF2/ C11orf43/ GRDF functional antibody |
| Target Antigen | GM-Tg-g-T90572-Ag | IGF2 protein |
| Cytokine | cks-Tg-g-GM-T90572 | insulin-like growth factor 2 (IGF2) protein & antibody |
| ORF Viral Vector | pGMLV000393 | Human IGF2 Lentivirus plasmid |
| ORF Viral Vector | pGMLV000475 | Human IGF2 Lentivirus plasmid |
| ORF Viral Vector | pGMAP000466 | Human IGF2 Adenovirus plasmid |
| ORF Viral Vector | vGMLV000393 | Human IGF2 Lentivirus particle |
| ORF Viral Vector | vGMLV000475 | Human IGF2 Lentivirus particle |
| ORF Viral Vector | vGMAP000466 | Human IGF2 Adenovirus particle |
Target information
| Target ID | GM-T90572 |
| Target Name | IGF2 |
| Gene ID | 3481, 16002, 710802, 24483, 101093644, 483664, 281240, 100034182 |
| Gene Symbol and Synonyms | C11orf43,GRDF,Igf-2,IGF-II,IGF2,IGFII,M6pr,Mpr,Peg2,PP9974,RNIGF2,SRS3 |
| Uniprot Accession | P01344 |
| Uniprot Entry Name | IGF2_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target, INN Index, Cytokine Target |
| Disease | Ovary Cancer |
| Gene Ensembl | ENSG00000167244 |
| Target Classification | Not Available |
This gene encodes a member of the insulin family of polypeptide growth factors, which are involved in development and growth. It is an imprinted gene, expressed only from the paternal allele, and epigenetic changes at this locus are associated with Wilms tumour, Beckwith-Wiedemann syndrome, rhabdomyosarcoma, and Silver-Russell syndrome. A read-through INS-IGF2 gene exists, whose 5' region overlaps the INS gene and the 3' region overlaps this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


