Human IGF2/FLJ22066/ FLJ44734 ORF/cDNA clone-Adenovirus particle (BC000531)

Pre-made Human IGF2/FLJ22066/ FLJ44734 Adenovirus for IGF2 overexpression in-vitro and in-vivo. The IGF2 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified IGF2-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to IGF2/FLJ22066 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000466 Human IGF2 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000466
Gene Name IGF2
Accession Number BC000531
Gene ID 3481
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 543 bp
Gene Alias FLJ22066, FLJ44734, INSIGF, pp9974
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGAATCCCAATGGGGAAGTCGATGCTGGTGCTTCTCACCTTCTTGGCCTTCGCCTCGTGCTGCATTGCTGCTTACCGCCCCAGTGAGACCCTGTGCGGCGGGGAGCTGGTGGACACCCTCCAGTTCGTCTGTGGGGACCGCGGCTTCTACTTCAGCAGGCCCGCAAGCCGTGTGAGCCGTCGCAGCCGTGGCATCGTTGAGGAGTGCTGTTTCCGCAGCTGTGACCTGGCCCTCCTGGAGACGTACTGTGCTACCCCCGCCAAGTCCGAGAGGGACGTGTCGACCCCTCCGACCGTGCTTCCGGACAACTTCCCCAGATACCCCGTGGGCAAGTTCTTCCAATATGACACCTGGAAGCAGTCCACCCAGCGCCTGCGCAGGGGCCTGCCTGCCCTCCTGCGTGCCCGCCGGGGTCACGTGCTCGCCAAGGAGCTCGAGGCGTTCAGGGAGGCCAAACGTCACCGTCCCCTGATTGCTCTACCCACCCAAGACCCCGCCCACGGGGGCGCCCCCCCAGAGATGGCCAGCAATCGGAAGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-634 Pre-Made Xentuzumab biosimilar, Whole mAb, Anti-IGF1;IGF2 Antibody: Anti-IGF/IGF-I/IGFI/MGF;C11orf43/GRDF/IGF-II/PP9974/SRS3 therapeutic antibody
    Biosimilar GMP-Bios-ab-160 Pre-Made Dusigitumab biosimilar, Whole mAb, Anti-IGF1;IGF2 Antibody: Anti-IGF/IGF-I/IGFI/MGF;C11orf43/GRDF/IGF-II/PP9974/SRS3 therapeutic antibody
    Target Antibody GM-Tg-g-T90572-Ab Anti-IGF2/ C11orf43/ GRDF functional antibody
    Target Antigen GM-Tg-g-T90572-Ag IGF2 protein
    Cytokine cks-Tg-g-GM-T90572 insulin-like growth factor 2 (IGF2) protein & antibody
    ORF Viral Vector pGMLV000050 Rat Igf2 Lentivirus plasmid
    ORF Viral Vector pGMLV000393 Human IGF2 Lentivirus plasmid
    ORF Viral Vector pGMLV000475 Human IGF2 Lentivirus plasmid
    ORF Viral Vector pGMLV001959 Rat Igf2 Lentivirus plasmid
    ORF Viral Vector pGMAD001135 Rat Igf2 Adenovirus plasmid
    ORF Viral Vector pGMAP000466 Human IGF2 Adenovirus plasmid
    ORF Viral Vector vGMLV000050 Rat Igf2 Lentivirus particle
    ORF Viral Vector vGMLV000393 Human IGF2 Lentivirus particle
    ORF Viral Vector vGMLV000475 Human IGF2 Lentivirus particle
    ORF Viral Vector vGMLV001959 Rat Igf2 Lentivirus particle
    ORF Viral Vector vGMAD001135 Rat Igf2 Adenovirus particle
    ORF Viral Vector vGMAP000466 Human IGF2 Adenovirus particle


    Target information

    Target ID GM-T90572
    Target Name IGF2
    Gene ID 3481, 16002, 710802, 24483, 101093644, 483664, 281240, 100034182
    Gene Symbol and Synonyms C11orf43,GRDF,Igf-2,IGF-II,IGF2,IGFII,M6pr,Mpr,Peg2,PP9974,RNIGF2,SRS3
    Uniprot Accession P01344
    Uniprot Entry Name IGF2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, INN Index, Cytokine Target
    Disease Ovary Cancer
    Gene Ensembl ENSG00000167244
    Target Classification Not Available

    This gene encodes a member of the insulin family of polypeptide growth factors, which are involved in development and growth. It is an imprinted gene, expressed only from the paternal allele, and epigenetic changes at this locus are associated with Wilms tumour, Beckwith-Wiedemann syndrome, rhabdomyosarcoma, and Silver-Russell syndrome. A read-through INS-IGF2 gene exists, whose 5' region overlaps the INS gene and the 3' region overlaps this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.