Human KCNN4/DHS2/hIKCa1 ORF/cDNA clone-Lentivirus plasmid (NM_002250)
Cat. No.: pGMLV000498
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human KCNN4/DHS2/hIKCa1 Lentiviral expression plasmid for KCNN4 lentivirus packaging, KCNN4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
KCNN4/DHS2 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMLV000498 |
| Gene Name | KCNN4 |
| Accession Number | NM_002250 |
| Gene ID | 3783 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 1284 bp |
| Gene Alias | DHS2,hIKCa1,hKCa4,hSK4,IK,IK1,IKCA1,KCa3.1,KCA4,SK4 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGGCGGGGATCTGGTGCTTGGCCTGGGGGCCTTGAGACGCCGAAAGCGCTTGCTGGAGCAGGAGAAGTCTCTGGCCGGCTGGGCACTGGTGCTGGCAGGAACTGGCATTGGACTCATGGTGCTGCATGCAGAGATGCTGTGGTTCGGGGGGTGCTCGTGGGCGCTCTACCTGTTCCTGGTTAAATGCACGATCAGCATTTCCACCTTCTTACTCCTCTGCCTCATCGTGGCCTTTCATGCCAAAGAGGTCCAGCTGTTCATGACCGACAACGGGCTGCGGGACTGGCGCGTGGCGCTGACCGGGCGGCAGGCGGCGCAGATCGTGCTGGAGCTGGTGGTGTGTGGGCTGCACCCGGCGCCCGTGCGGGGCCCGCCGTGCGTGCAGGATTTAGGGGCGCCGCTGACCTCCCCGCAGCCCTGGCCGGGATTCCTGGGCCAAGGGGAAGCGCTGCTGTCCCTGGCCATGCTGCTGCGTCTCTACCTGGTGCCCCGCGCCGTGCTCCTGCGCAGCGGCGTCCTGCTCAACGCTTCCTACCGCAGCATCGGCGCTCTCAATCAAGTCCGCTTCCGCCACTGGTTCGTGGCCAAGCTTTACATGAACACGCACCCTGGCCGCCTGCTGCTCGGCCTCACGCTTGGCCTCTGGCTGACCACCGCCTGGGTGCTGTCCGTGGCCGAGAGGCAGGCTGTTAATGCCACTGGGCACCTTTCAGACACACTTTGGCTGATCCCCATCACATTCCTGACCATCGGCTATGGTGACGTGGTGCCGGGCACCATGTGGGGCAAGATCGTCTGCCTGTGCACTGGAGTCATGGGTGTCTGCTGCACAGCCCTGCTGGTGGCCGTGGTGGCCCGGAAGCTGGAGTTTAACAAGGCAGAGAAGCACGTGCACAACTTCATGATGGATATCCAGTATACCAAAGAGATGAAGGAGTCCGCTGCCCGAGTGCTACAAGAAGCCTGGATGTTCTACAAACATACTCGCAGGAAGGAGTCTCATGCTGCCCGCAGGCATCAGCGCAAGCTGCTGGCCGCCATCAACGCGTTCCGCCAGGTGCGGCTGAAACACCGGAAGCTCCGGGAACAAGTGAACTCCATGGTGGACATCTCCAAGATGCACATGATCCTGTATGACCTGCAGCAGAATCTGAGCAGCTCACACCGGGCCCTGGAGAAACAGATTGACACGCTGGCGGGGAAGCTGGATGCCCTGACTGAGCTGCTTAGCACTGCCCTGGGGCCGAGGCAGCTTCCAGAACCCAGCCAGCAGTCCAAGTAG |
| ORF Protein Sequence | MGGDLVLGLGALRRRKRLLEQEKSLAGWALVLAGTGIGLMVLHAEMLWFGGCSWALYLFLVKCTISISTFLLLCLIVAFHAKEVQLFMTDNGLRDWRVALTGRQAAQIVLELVVCGLHPAPVRGPPCVQDLGAPLTSPQPWPGFLGQGEALLSLAMLLRLYLVPRAVLLRSGVLLNASYRSIGALNQVRFRHWFVAKLYMNTHPGRLLLGLTLGLWLTTAWVLSVAERQAVNATGHLSDTLWLIPITFLTIGYGDVVPGTMWGKIVCLCTGVMGVCCTALLVAVVARKLEFNKAEKHVHNFMMDIQYTKEMKESAARVLQEAWMFYKHTRRKESHAARRHQRKLLAAINAFRQVRLKHRKLREQVNSMVDISKMHMILYDLQQNLSSSHRALEKQIDTLAGKLDALTELLSTALGPRQLPEPSQQSK |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T42724-Ab | Anti-KCNN4/ DHS2/ IK monoclonal antibody |
| Target Antigen | GM-Tg-g-T42724-Ag | KCNN4 VLP (virus-like particle) |
| ORF Viral Vector | pGMLV000294 | Human KCNN4 Lentivirus plasmid |
| ORF Viral Vector | pGMLV000498 | Human KCNN4 Lentivirus plasmid |
| ORF Viral Vector | vGMLV000294 | Human KCNN4 Lentivirus particle |
| ORF Viral Vector | vGMLV000498 | Human KCNN4 Lentivirus particle |
Target information
| Target ID | GM-T42724 |
| Target Name | KCNN4 |
| Gene ID | 3783, 16534, 712383, 65206, 101090475, 484464, 534591, 100147493 |
| Gene Symbol and Synonyms | DHS2,hIKCa1,hKCa4,hSK4,IK,IK1,IKCA1,KCa3.1,KCA4,KCNN4,mIKCa1,rKCNN4c,rSK4,SK4,SKCas |
| Uniprot Accession | O15554 |
| Uniprot Entry Name | KCNN4_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target |
| Disease | Not Available |
| Gene Ensembl | ENSG00000104783 |
| Target Classification | Not Available |
The protein encoded by this gene is part of a potentially heterotetrameric voltage-independent potassium channel that is activated by intracellular calcium. Activation is followed by membrane hyperpolarization, which promotes calcium influx. The encoded protein may be part of the predominant calcium-activated potassium channel in T-lymphocytes. This gene is similar to other KCNN family potassium channel genes, but it differs enough to possibly be considered as part of a new subfamily. [provided by RefSeq, Jul 2008]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


