Human SOD2/GClnc1/ IPO-B ORF/cDNA clone-Lentivirus plasmid (NM_000636.4)
Pre-made Human SOD2/GClnc1/ IPO-B Lentiviral expression plasmid for SOD2 lentivirus packaging, SOD2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to SOD Mn/SOD2/GClnc1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLV001195 | Human SOD2 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLV001195 |
Gene Name | SOD2 |
Accession Number | NM_000636.4 |
Gene ID | 6648 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 669 bp |
Gene Alias | GClnc1, IPO-B, IPOB, Mn-SOD, MNSOD, MVCD6 |
Fluorescent Reporter | |
Mammalian Cell Selection | Puromyocinmyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTTGAGCCGGGCAGTGTGCGGCACCAGCAGGCAGCTGGCTCCGGTTTTGGGGTATCTGGGCTCCAGGCAGAAGCACAGCCTCCCCGACCTGCCCTACGACTACGGCGCCCTGGAACCTCACATCAACGCGCAGATCATGCAGCTGCACCACAGCAAGCACCACGCGGCCTACGTGAACAACCTGAACGTCACCGAGGAGAAGTACCAGGAGGCGTTGGCCAAGGGAGATGTTACAGCCCAGATAGCTCTTCAGCCTGCACTGAAGTTCAATGGTGGTGGTCATATCAATCATAGCATTTTCTGGACAAACCTCAGCCCTAACGGTGGTGGAGAACCCAAAGGGGAGTTGCTGGAAGCCATCAAACGTGACTTTGGTTCCTTTGACAAGTTTAAGGAGAAGCTGACGGCTGCATCTGTTGGTGTCCAAGGCTCAGGTTGGGGTTGGCTTGGTTTCAATAAGGAACGGGGACACTTACAAATTGCTGCTTGTCCAAATCAGGATCCACTGCAAGGAACAACAGGCCTTATTCCACTGCTGGGGATTGATGTGTGGGAGCACGCTTACTACCTTCAGTATAAAAATGTCAGGCCTGATTATCTAAAAGCTATTTGGAATGTAATCAACTGGGAGAATGTAACTGAAAGATACATGGCTTGCAAAAAGTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T89147-Ab | Anti-SOD Mn monoclonal antibody |
Target Antigen | GM-Tg-g-T89147-Ag | SOD Mn/SOD2 protein |
ORF Viral Vector | pGMLV001195 | Human SOD2 Lentivirus plasmid |
ORF Viral Vector | pGMLV001938 | Human SOD2 Lentivirus plasmid |
ORF Viral Vector | pGMAAV000363 | Human SOD2 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMAP000391 | Human SOD2 Adenovirus plasmid |
ORF Viral Vector | vGMLV001195 | Human SOD2 Lentivirus particle |
ORF Viral Vector | vGMLV001938 | Human SOD2 Lentivirus particle |
ORF Viral Vector | vGMAAV000363 | Human SOD2 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMAP000391 | Human SOD2 Adenovirus particle |
Target information
Target ID | GM-T89147 |
Target Name | SOD Mn |
Gene ID | 6648, 20656, 574097, 24787, 101096985, 476258, 281496, 100034223 |
Gene Symbol and Synonyms | GC1,GClnc1,IPO-B,IPOB,Mn-SOD,MNSOD,MVCD6,Sod-2,SOD2,SOD2X1,SOD2X2 |
Uniprot Accession | P04179 |
Uniprot Entry Name | SODM_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000112096 |
Target Classification | Tumor-associated antigen (TAA) |
This gene is a member of the iron/manganese superoxide dismutase family. It encodes a mitochondrial protein that forms a homotetramer and binds one manganese ion per subunit. This protein binds to the superoxide byproducts of oxidative phosphorylation and converts them to hydrogen peroxide and diatomic oxygen. Mutations in this gene have been associated with idiopathic cardiomyopathy (IDC), premature aging, sporadic motor neuron disease, and cancer. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 1. [provided by RefSeq, Apr 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.