Human SOD2/GClnc1/ IPO-B ORF/cDNA clone-Lentivirus plasmid (NM_000636.4)

Pre-made Human SOD2/GClnc1/ IPO-B Lentiviral expression plasmid for SOD2 lentivirus packaging, SOD2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to SOD Mn/SOD2/GClnc1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLV001195 Human SOD2 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLV001195
Gene Name SOD2
Accession Number NM_000636.4
Gene ID 6648
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 669 bp
Gene Alias GClnc1, IPO-B, IPOB, Mn-SOD, MNSOD, MVCD6
Fluorescent Reporter
Mammalian Cell Selection Puromyocinmyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTTGAGCCGGGCAGTGTGCGGCACCAGCAGGCAGCTGGCTCCGGTTTTGGGGTATCTGGGCTCCAGGCAGAAGCACAGCCTCCCCGACCTGCCCTACGACTACGGCGCCCTGGAACCTCACATCAACGCGCAGATCATGCAGCTGCACCACAGCAAGCACCACGCGGCCTACGTGAACAACCTGAACGTCACCGAGGAGAAGTACCAGGAGGCGTTGGCCAAGGGAGATGTTACAGCCCAGATAGCTCTTCAGCCTGCACTGAAGTTCAATGGTGGTGGTCATATCAATCATAGCATTTTCTGGACAAACCTCAGCCCTAACGGTGGTGGAGAACCCAAAGGGGAGTTGCTGGAAGCCATCAAACGTGACTTTGGTTCCTTTGACAAGTTTAAGGAGAAGCTGACGGCTGCATCTGTTGGTGTCCAAGGCTCAGGTTGGGGTTGGCTTGGTTTCAATAAGGAACGGGGACACTTACAAATTGCTGCTTGTCCAAATCAGGATCCACTGCAAGGAACAACAGGCCTTATTCCACTGCTGGGGATTGATGTGTGGGAGCACGCTTACTACCTTCAGTATAAAAATGTCAGGCCTGATTATCTAAAAGCTATTTGGAATGTAATCAACTGGGAGAATGTAACTGAAAGATACATGGCTTGCAAAAAGTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T89147-Ab Anti-SOD Mn monoclonal antibody
    Target Antigen GM-Tg-g-T89147-Ag SOD Mn/SOD2 protein
    ORF Viral Vector pGMLV001195 Human SOD2 Lentivirus plasmid
    ORF Viral Vector pGMLV001938 Human SOD2 Lentivirus plasmid
    ORF Viral Vector pGMAAV000363 Human SOD2 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAP000391 Human SOD2 Adenovirus plasmid
    ORF Viral Vector vGMLV001195 Human SOD2 Lentivirus particle
    ORF Viral Vector vGMLV001938 Human SOD2 Lentivirus particle
    ORF Viral Vector vGMAAV000363 Human SOD2 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAP000391 Human SOD2 Adenovirus particle


    Target information

    Target ID GM-T89147
    Target Name SOD Mn
    Gene ID 6648, 20656, 574097, 24787, 101096985, 476258, 281496, 100034223
    Gene Symbol and Synonyms GC1,GClnc1,IPO-B,IPOB,Mn-SOD,MNSOD,MVCD6,Sod-2,SOD2,SOD2X1,SOD2X2
    Uniprot Accession P04179
    Uniprot Entry Name SODM_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000112096
    Target Classification Tumor-associated antigen (TAA)

    This gene is a member of the iron/manganese superoxide dismutase family. It encodes a mitochondrial protein that forms a homotetramer and binds one manganese ion per subunit. This protein binds to the superoxide byproducts of oxidative phosphorylation and converts them to hydrogen peroxide and diatomic oxygen. Mutations in this gene have been associated with idiopathic cardiomyopathy (IDC), premature aging, sporadic motor neuron disease, and cancer. Alternative splicing of this gene results in multiple transcript variants. A related pseudogene has been identified on chromosome 1. [provided by RefSeq, Apr 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.