Human FGF21 ORF/cDNA clone-Lentivirus plasmid (NM_019113.4)

Pre-made Human FGF21/ Lentiviral expression plasmid for FGF21 lentivirus packaging, FGF21 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to FGF21/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLV001311 Human FGF21 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLV001311
Gene Name FGF21
Accession Number NM_019113.4
Gene ID 26291
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 630 bp
Gene Alias
Fluorescent Reporter
Mammalian Cell Selection Puromyocinmyocin
Fusion Tag Null
Promoter CMV
Resistance Amplicin
Sequence ATGGACTCGGACGAGACCGGGTTCGAGCACTCAGGACTGTGGGTTTCTGTGCTGGCTGGTCTTCTGCTGGGAGCCTGCCAGGCACACCCCATCCCTGACTCCAGTCCTCTCCTGCAATTCGGGGGCCAAGTCCGGCAGCGGTACCTCTACACAGATGATGCCCAGCAGACAGAAGCCCACCTGGAGATCAGGGAGGATGGGACGGTGGGGGGCGCTGCTGACCAGAGCCCCGAAAGTCTCCTGCAGCTGAAAGCCTTGAAGCCGGGAGTTATTCAAATCTTGGGAGTCAAGACATCCAGGTTCCTGTGCCAGCGGCCAGATGGGGCCCTGTATGGATCGCTCCACTTTGACCCTGAGGCCTGCAGCTTCCGGGAGCTGCTTCTTGAGGACGGATACAATGTTTACCAGTCCGAAGCCCACGGCCTCCCGCTGCACCTGCCAGGGAACAAGTCCCCACACCGGGACCCTGCACCCCGAGGACCAGCTCGCTTCCTGCCACTACCAGGCCTGCCCCCCGCACTCCCGGAGCCACCCGGAATCCTGGCCCCCCAGCCCCCCGATGTGGGCTCCTCGGACCCTCTGAGCATGGTGGGACCTTCCCAGGGCCGAAGCCCCAGCTACGCTTCCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T42928-Ab Anti-FGF21 functional antibody
    Target Antigen GM-Tg-g-T42928-Ag FGF21 protein
    Cytokine cks-Tg-g-GM-T42928 fibroblast growth factor 21 (FGF21) protein & antibody
    ORF Viral Vector pGMLV001311 Human FGF21 Lentivirus plasmid
    ORF Viral Vector pGMAAV000245 Human FGF21 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMLP003451 Human FGF21 Lentivirus plasmid
    ORF Viral Vector vGMLV001311 Human FGF21 Lentivirus particle
    ORF Viral Vector vGMAAV000245 Human FGF21 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMLP003451 Human FGF21 Lentivirus particle
    ORF Viral Vector pGMLV002194 Human FGF21 Lentivirus plasmid


    Target information

    Target ID GM-T42928
    Target Name FGF21
    Gene ID 26291, 56636, 718288, 170580, 101080595, 484395, 785576, 100054542
    Gene Symbol and Synonyms FGF21,Fgf8c
    Uniprot Accession Q9NSA1
    Uniprot Entry Name FGF21_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease Not Available
    Gene Ensembl ENSG00000105550
    Target Classification Not Available

    Theis gene encodes a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities and are involved in a variety of biological processes. This protein is a secreted endocrine factor that functions as a major metabolic regulator. The encoded protein stimulates the uptake of glucose in adipose tissue. [provided by RefSeq, Mar 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.