Human FGF21 ORF/cDNA clone-Lentivirus particle (NM_019113.4)
Pre-made Human FGF21/ Lentiviral expression plasmid for FGF21 lentivirus packaging, FGF21 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to FGF21/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLV001311 | Human FGF21 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLV001311 |
Gene Name | FGF21 |
Accession Number | NM_019113.4 |
Gene ID | 26291 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 630 bp |
Gene Alias | |
Fluorescent Reporter | |
Mammalian Cell Selection | Puromyocinmyocin |
Fusion Tag | Null |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGACTCGGACGAGACCGGGTTCGAGCACTCAGGACTGTGGGTTTCTGTGCTGGCTGGTCTTCTGCTGGGAGCCTGCCAGGCACACCCCATCCCTGACTCCAGTCCTCTCCTGCAATTCGGGGGCCAAGTCCGGCAGCGGTACCTCTACACAGATGATGCCCAGCAGACAGAAGCCCACCTGGAGATCAGGGAGGATGGGACGGTGGGGGGCGCTGCTGACCAGAGCCCCGAAAGTCTCCTGCAGCTGAAAGCCTTGAAGCCGGGAGTTATTCAAATCTTGGGAGTCAAGACATCCAGGTTCCTGTGCCAGCGGCCAGATGGGGCCCTGTATGGATCGCTCCACTTTGACCCTGAGGCCTGCAGCTTCCGGGAGCTGCTTCTTGAGGACGGATACAATGTTTACCAGTCCGAAGCCCACGGCCTCCCGCTGCACCTGCCAGGGAACAAGTCCCCACACCGGGACCCTGCACCCCGAGGACCAGCTCGCTTCCTGCCACTACCAGGCCTGCCCCCCGCACTCCCGGAGCCACCCGGAATCCTGGCCCCCCAGCCCCCCGATGTGGGCTCCTCGGACCCTCTGAGCATGGTGGGACCTTCCCAGGGCCGAAGCCCCAGCTACGCTTCCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T42928-Ab | Anti-FGF21 functional antibody |
Target Antigen | GM-Tg-g-T42928-Ag | FGF21 protein |
Cytokine | cks-Tg-g-GM-T42928 | fibroblast growth factor 21 (FGF21) protein & antibody |
ORF Viral Vector | pGMLV001311 | Human FGF21 Lentivirus plasmid |
ORF Viral Vector | pGMAAV000245 | Human FGF21 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMLP003451 | Human FGF21 Lentivirus plasmid |
ORF Viral Vector | vGMLV001311 | Human FGF21 Lentivirus particle |
ORF Viral Vector | vGMAAV000245 | Human FGF21 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMLP003451 | Human FGF21 Lentivirus particle |
ORF Viral Vector | pGMLV002194 | Human FGF21 Lentivirus plasmid |
Target information
Target ID | GM-T42928 |
Target Name | FGF21 |
Gene ID | 26291, 56636, 718288, 170580, 101080595, 484395, 785576, 100054542 |
Gene Symbol and Synonyms | FGF21,Fgf8c |
Uniprot Accession | Q9NSA1 |
Uniprot Entry Name | FGF21_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | Not Available |
Gene Ensembl | ENSG00000105550 |
Target Classification | Not Available |
Theis gene encodes a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities and are involved in a variety of biological processes. This protein is a secreted endocrine factor that functions as a major metabolic regulator. The encoded protein stimulates the uptake of glucose in adipose tissue. [provided by RefSeq, Mar 2016]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.