Human TIGIT/VSIG9/VSTM3 ORF/cDNA clone-Lentivirus plasmid (NM_173799.4)

Cat. No.: pGMLV001721
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TIGIT/VSIG9/VSTM3 Lentiviral expression plasmid for TIGIT lentivirus packaging, TIGIT lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to TIGIT/VSIG9 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $483.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV001721
Gene Name TIGIT
Accession Number NM_173799.4
Gene ID 201633
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 735 bp
Gene Alias VSIG9,VSTM3,WUCAM
Fluorescent Reporter null
Mammalian Cell Selection Neomycin
Fusion Tag Null
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCGCTGGTGTCTCCTCCTGATCTGGGCCCAGGGGCTGAGGCAGGCTCCCCTCGCCTCAGGAATGATGACAGGCACAATAGAAACAACGGGGAACATTTCTGCAGAGAAAGGTGGCTCTATCATCTTACAATGTCACCTCTCCTCCACCACGGCACAAGTGACCCAGGTCAACTGGGAGCAGCAGGACCAGCTTCTGGCCATTTGTAATGCTGACTTGGGGTGGCACATCTCCCCATCCTTCAAGGATCGAGTGGCCCCAGGTCCCGGCCTGGGCCTCACCCTCCAGTCGCTGACCGTGAACGATACAGGGGAGTACTTCTGCATCTATCACACCTACCCTGATGGGACGTACACTGGGAGAATCTTCCTGGAGGTCCTAGAAAGCTCAGTGGCTGAGCACGGTGCCAGGTTCCAGATTCCATTGCTTGGAGCCATGGCCGCGACGCTGGTGGTCATCTGCACAGCAGTCATCGTGGTGGTCGCGTTGACTAGAAAGAAGAAAGCCCTCAGAATCCATTCTGTGGAAGGTGACCTCAGGAGAAAATCAGCTGGACAGGAGGAATGGAGCCCCAGTGCTCCCTCACCCCCAGGAAGCTGTGTCCAGGCAGAAGCTGCACCTGCTGGGCTCTGTGGAGAGCAGCGGGGAGAGGACTGTGCCGAGCTGCATGACTACTTCAATGTCCTGAGTTACAGAAGCCTGGGTAACTGCAGCTTCTTCACAGAGACTGGTTAG
ORF Protein Sequence MRWCLLLIWAQGLRQAPLASGMMTGTIETTGNISAEKGGSIILQCHLSSTTAQVTQVNWEQQDQLLAICNADLGWHISPSFKDRVAPGPGLGLTLQSLTVNDTGEYFCIYHTYPDGTYTGRIFLEVLESSVAEHGARFQIPLLGAMAATLVVICTAVIVVVALTRKKKALRIHSVEGDLRRKSAGQEEWSPSAPSPPGSCVQAEAAPAGLCGEQRGEDCAELHDYFNVLSYRSLGNCSFFTETG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-699 Pre-Made Tamgiblimab biosimilar, Whole mAb, Anti-TIGIT Antibody: Anti-VSIG9/VSTM3/WUCAM therapeutic antibody
    Biosimilar GMP-Bios-ab-620 Pre-Made Vibostolimab biosimilar, Whole mAb, Anti-TIGIT Antibody: Anti-VSIG9/VSTM3/WUCAM therapeutic antibody
    Biosimilar GMP-Bios-ab-198 Pre-Made Etigilimab biosimilar, Whole mAb, Anti-TIGIT Antibody: Anti-VSIG9/VSTM3/WUCAM therapeutic antibody
    Biosimilar GMP-Bios-ab-388 Pre-Made Ociperlimab biosimilar, Whole mAb, Anti-TIGIT Antibody: Anti-VSIG9/VSTM3/WUCAM therapeutic antibody
    Biosimilar GMP-Bios-ab-579 Pre-Made Tiragolumab biosimilar, Whole mAb, Anti-TIGIT Antibody: Anti-VSIG9/VSTM3/WUCAM therapeutic antibody
    Biosimilar GMP-Bios-ab-152 Pre-Made Domvanalimab biosimilar, Whole mAb, Anti-TIGIT Antibody: Anti-VSIG9/VSTM3/WUCAM therapeutic antibody
    Target Antibody GM-Tg-g-T40874-Ab Anti-TIGIT/ VSIG9/ VSTM3 monoclonal antibody
    Target Antigen GM-Tg-g-T40874-Ag TIGIT VLP (virus-like particle)
    ORF Viral Vector pGMLP004203 Human TIGIT Lentivirus plasmid
    ORF Viral Vector pGMLV001721 Human TIGIT Lentivirus plasmid
    ORF Viral Vector pGMPC004773 Human TIGIT Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP004203 Human TIGIT Lentivirus particle
    ORF Viral Vector vGMLV001721 Human TIGIT Lentivirus particle


    Target information

    Target ID GM-T40874
    Target Name TIGIT
    Gene ID 201633, 100043314, 710941, 363784, 101098326, 487986, 100140801, 100071301
    Gene Symbol and Synonyms RGD1563191,TIGIT,VSIG9,VSTM3,WUCAM
    Uniprot Accession Q495A1
    Uniprot Entry Name TIGIT_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease Not Available
    Gene Ensembl ENSG00000181847
    Target Classification Checkpoint-Immuno Oncology

    This gene encodes a member of the PVR (poliovirus receptor) family of immunoglobin proteins. The product of this gene is expressed on several classes of T cells including follicular B helper T cells (TFH). The protein has been shown to bind PVR with high affinity; this binding is thought to assist interactions between TFH and dendritic cells to regulate T cell dependent B cell responses.[provided by RefSeq, Sep 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.