Human RTN4/ASY/ Nbla00271 ORF/cDNA clone-Lentivirus plasmid (NM_153828.3)
Pre-made Human RTN4/ASY/ Nbla00271 Lentiviral expression plasmid for RTN4 lentivirus packaging, RTN4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to RTN4/ASY products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLV001875 | Human RTN4 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLV001875 |
Gene Name | RTN4 |
Accession Number | NM_153828.3 |
Gene ID | 57142 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1122 bp |
Gene Alias | ASY, Nbla00271, Nbla10545, NI220/250, NOGO, NSP, NSP-CL, RTN-X, RTN4-A, RTN4-B1, RTN4-B2, RTN4-C |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocinmyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGAAGACCTGGACCAGTCTCCTCTGGTCTCGTCCTCGGACAGCCCACCCCGGCCGCAGCCCGCGTTCAAGTACCAGTTCGTGAGGGAGCCCGAGGACGAGGAGGAAGAAGAGGAGGAGGAAGAGGAGGACGAGGACGAAGACCTGGAGGAGCTGGAGGTGCTGGAGAGGAAGCCCGCCGCCGGGCTGTCCGCGGCCCCAGTGCCCACCGCCCCTGCCGCCGGCGCGCCCCTGATGGACTTCGGAAATGACTTCGTGCCGCCGGCGCCCCGGGGACCCCTGCCGGCCGCTCCCCCCGTCGCCCCGGAGCGGCAGCCGTCTTGGGACCCGAGCCCGGTGTCGTCGACCGTGCCCGCGCCATCCCCGCTGTCTGCTGCCGCAGTCTCGCCCTCCAAGCTCCCTGAGGACGACGAGCCTCCGGCCCGGCCTCCCCCTCCTCCCCCGGCCAGCGTGAGCCCCCAGGCAGAGCCCGTGTGGACCCCGCCAGCCCCGGCTCCCGCCGCGCCCCCCTCCACCCCGGCCGCGCCCAAGCGCAGGGGCTCCTCGGGCTCAGTGGTTGTTGACCTCCTGTACTGGAGAGACATTAAGAAGACTGGAGTGGTGTTTGGTGCCAGCCTATTCCTGCTGCTTTCATTGACAGTATTCAGCATTGTGAGCGTAACAGCCTACATTGCCTTGGCCCTGCTCTCTGTGACCATCAGCTTTAGGATATACAAGGGTGTGATCCAAGCTATCCAGAAATCAGATGAAGGCCACCCATTCAGGGCATATCTGGAATCTGAAGTTGCTATATCTGAGGAGTTGGTTCAGAAGTACAGTAATTCTGCTCTTGGTCATGTGAACTGCACGATAAAGGAACTCAGGCGCCTCTTCTTAGTTGATGATTTAGTTGATTCTCTGAAGTTTGCAGTGTTGATGTGGGTATTTACCTATGTTGGTGCCTTGTTTAATGGTCTGACACTACTGATTTTGGCTCTCATTTCACTCTTCAGTGTTCCTGTTATTTATGAACGGCATCAGGCACAGATAGATCATTATCTAGGACTTGCAAATAAGAATGTTAAAGATGCTATGGCTAAAATCCAAGCAAAAATCCCTGGATTGAAGCGCAAAGCTGAATGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Target information
Target ID | GM-T70062 |
Target Name | RTN4 |
Gene ID | 57142, 68585, 619181, 83765, 101091611, 474598, 359718, 100066612 |
Gene Symbol and Synonyms | 1110020G17Rik,ASY,C130026I10Rik,mKIAA0886,mKIAA4153,Nbla00271,Nbla10545,NgA,NI-250,NI220/250,NOGO,Nogo-A,Nogo-B,Nogo-C,NSP,NSP-CL,rat N,rat NogoA,RTN-X,RTN4,RTN4-A,RTN4-B1,RTN4-B2,RTN4-C,RTN4-Cw,Vp20 |
Uniprot Accession | Q9NQC3 |
Uniprot Entry Name | RTN4_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, INN Index |
Disease | Not Available |
Gene Ensembl | ENSG00000115310 |
Target Classification | Not Available |
This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.