Human RTN4/ASY/ Nbla00271 ORF/cDNA clone-Lentivirus particle (NM_007008)

Pre-made Human RTN4/ASY/ Nbla00271 Lentiviral expression plasmid for RTN4 lentivirus packaging, RTN4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to RTN4/ASY products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP002802 Human RTN4 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP002802
Gene Name RTN4
Accession Number NM_007008
Gene ID 57142
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 600 bp
Gene Alias ASY, Nbla00271, Nbla10545, NI220/250, NOGO, NSP, NSP-CL, RTN-X, RTN4-A, RTN4-B1, RTN4-B2, RTN4-C
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGACGGTCAGAAGAAAAATTGGAAGGACAAGGTTGTTGACCTCCTGTACTGGAGAGACATTAAGAAGACTGGAGTGGTGTTTGGTGCCAGCCTATTCCTGCTGCTTTCATTGACAGTATTCAGCATTGTGAGCGTAACAGCCTACATTGCCTTGGCCCTGCTCTCTGTGACCATCAGCTTTAGGATATACAAGGGTGTGATCCAAGCTATCCAGAAATCAGATGAAGGCCACCCATTCAGGGCATATCTGGAATCTGAAGTTGCTATATCTGAGGAGTTGGTTCAGAAGTACAGTAATTCTGCTCTTGGTCATGTGAACTGCACGATAAAGGAACTCAGGCGCCTCTTCTTAGTTGATGATTTAGTTGATTCTCTGAAGTTTGCAGTGTTGATGTGGGTATTTACCTATGTTGGTGCCTTGTTTAATGGTCTGACACTACTGATTTTGGCTCTCATTTCACTCTTCAGTGTTCCTGTTATTTATGAACGGCATCAGGCACAGATAGATCATTATCTAGGACTTGCAAATAAGAATGTTAAAGATGCTATGGCTAAAATCCAAGCAAAAATCCCTGGATTGAAGCGCAAAGCTGAATGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-037 Pre-Made Atinumab biosimilar, Whole mAb, Anti-RTN4 Antibody: Anti-ASY/NI220/250/NOGO/NSP/NSP-CL/Nbla00271/Nbla10545/RTN-X-B1-B2 therapeutic antibody
    Biosimilar GMP-Bios-ab-418 Pre-Made Ozanezumab biosimilar, Whole mAb, Anti-RTN4 Antibody: Anti-ASY/NI220/250/NOGO/NSP/NSP-CL/Nbla00271/Nbla10545/RTN-X-B1-B2 therapeutic antibody
    Target Antibody GM-Tg-g-T70062-Ab Anti-RTN4/ ASY/ NI220/250 monoclonal antibody
    Target Antigen GM-Tg-g-T70062-Ag RTN4 VLP (virus-like particle)
    ORF Viral Vector pGMLV000586 Rat Rtn4 Lentivirus plasmid
    ORF Viral Vector pGMLV001875 Human RTN4 Lentivirus plasmid
    ORF Viral Vector pGMAD001226 Human RTN4 Adenovirus plasmid
    ORF Viral Vector pGMPC000891 Human RTN4 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP002802 Human RTN4 Lentivirus plasmid
    ORF Viral Vector vGMLV000586 Rat Rtn4 Lentivirus particle
    ORF Viral Vector vGMLV001875 Human RTN4 Lentivirus particle
    ORF Viral Vector vGMAD001226 Human RTN4 Adenovirus particle
    ORF Viral Vector vGMLP002802 Human RTN4 Lentivirus particle


    Target information

    Target ID GM-T70062
    Target Name RTN4
    Gene ID 57142, 68585, 619181, 83765, 101091611, 474598, 359718, 100066612
    Gene Symbol and Synonyms 1110020G17Rik,ASY,C130026I10Rik,mKIAA0886,mKIAA4153,Nbla00271,Nbla10545,NgA,NI-250,NI220/250,NOGO,Nogo-A,Nogo-B,Nogo-C,NSP,NSP-CL,rat N,rat NogoA,RTN-X,RTN4,RTN4-A,RTN4-B1,RTN4-B2,RTN4-C,RTN4-Cw,Vp20
    Uniprot Accession Q9NQC3
    Uniprot Entry Name RTN4_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, INN Index
    Disease Not Available
    Gene Ensembl ENSG00000115310
    Target Classification Not Available

    This gene belongs to the family of reticulon encoding genes. Reticulons are associated with the endoplasmic reticulum, and are involved in neuroendocrine secretion or in membrane trafficking in neuroendocrine cells. The product of this gene is a potent neurite outgrowth inhibitor which may also help block the regeneration of the central nervous system in higher vertebrates. Alternatively spliced transcript variants derived both from differential splicing and differential promoter usage and encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.