Human MRGPRE/GPR167/MGRF ORF/cDNA clone-Lentivirus plasmid (NM_001039165.4)

Cat. No.: pGMLV002654
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MRGPRE/GPR167/MGRF Lentiviral expression plasmid for MRGPRE lentivirus packaging, MRGPRE lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to MRGPRE/GPR167 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $534.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV002654
Gene Name MRGPRE
Accession Number NM_001039165.4
Gene ID 116534
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 939 bp
Gene Alias GPR167,MGRF,MRGE
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGATGGAGCCCAGAGAAGCTGGACAGCACGTGGGGGCCGCCAACGGCGCCCAGGAGGATGTGGCCTTCAACCTCATCATCCTGTCCCTCACCGAGGGGCTCGGCCTCGGTGGGCTGCTGGGGAATGGGGCAGTCCTCTGGCTGCTCAGCTCCAATGTCTACAGAAACCCCTTCGCCATCTACCTCCTGGACGTGGCCTGCGCGGATCTCATCTTCCTTGGCTGCCACATGGTGGCCATCGTCCCCGACTTGCTGCAAGGCCGGCTGGACTTCCCGGGCTTCGTGCAGACCAGCCTGGCAACGCTGCGCTTCTTCTGCTACATCGTGGGCCTGAGTCTCCTGGCGGCCGTCAGCGTGGAGCAGTGCCTGGCCGCCCTCTTCCCAGCCTGGTACTCGTGCCGCCGCCCACGCCACCTGACCACCTGTGTGTGCGCCCTCACCTGGGCCCTCTGCCTGCTGCTGCACCTGCTGCTCAGCGGCGCCTGCACCCAGTTCTTCGGGGAGCCCAGCCGCCACTTGTGCCGGACGCTGTGGCTGGTGGCAGCGGTGCTGCTGGCTCTGCTGTGTTGCACCATGTGTGGGGCCAGCCTTATGCTGCTGCTGCGGGTGGAGCGAGGCCCCCAGCGGCCCCCACCCCGGGGCTTCCCTGGGCTCATCCTCCTCACCGTCCTCCTCTTCCTCTTCTGCGGCCTGCCCTTCGGCATCTACTGGCTGTCCCGGAACCTGCTCTGGTACATCCCCCACTACTTCTACCACTTCAGCTTCCTCATGGCCGCCGTGCACTGCGCGGCCAAGCCCGTCGTCTACTTCTGCCTGGGCAGTGCCCAGGGCCGCAGGCTGCCCCTCCGGCTGGTCCTCCAGCGAGCGCTGGGAGACGAGGCTGAGCTGGGGGCCGTCAGGGAGACCTCCCGCCGGGGCCTGGTGGACATAGCAGCCTGA
ORF Protein Sequence MMEPREAGQHVGAANGAQEDVAFNLIILSLTEGLGLGGLLGNGAVLWLLSSNVYRNPFAIYLLDVACADLIFLGCHMVAIVPDLLQGRLDFPGFVQTSLATLRFFCYIVGLSLLAAVSVEQCLAALFPAWYSCRRPRHLTTCVCALTWALCLLLHLLLSGACTQFFGEPSRHLCRTLWLVAAVLLALLCCTMCGASLMLLLRVERGPQRPPPRGFPGLILLTVLLFLFCGLPFGIYWLSRNLLWYIPHYFYHFSFLMAAVHCAAKPVVYFCLGSAQGRRLPLRLVLQRALGDEAELGAVRETSRRGLVDIAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0831-Ab Anti-MRGRE/ MRGPRE/ GPR167 monoclonal antibody
    Target Antigen GM-Tg-g-MP0831-Ag MRGPRE VLP (virus-like particle)
    ORF Viral Vector pGMLV002654 Human MRGPRE Lentivirus plasmid
    ORF Viral Vector vGMLV002654 Human MRGPRE Lentivirus particle


    Target information

    Target ID GM-MP0831
    Target Name MRGPRE
    Gene ID 116534, 244238, 706822, 404660, 123380252
    Gene Symbol and Synonyms C130069N09Rik,Ebrt3,GPR167,MGRF,MRGE,MRGPRE
    Uniprot Accession Q86SM8
    Uniprot Entry Name MRGRE_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000184350
    Target Classification GPCR

    Predicted to enable G protein-coupled receptor activity. Predicted to be involved in G protein-coupled receptor signaling pathway. Predicted to be located in plasma membrane. Predicted to be integral component of membrane. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.