Human OGN/OG/OIF ORF/cDNA clone-Lentivirus plasmid (NM_014057.5)
Cat. No.: pGMLV002694
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human OGN/OG/OIF Lentiviral expression plasmid for OGN lentivirus packaging, OGN lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
OGN/OG products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMLV002694 |
| Gene Name | OGN |
| Accession Number | NM_014057.5 |
| Gene ID | 4969 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 897 bp |
| Gene Alias | OG,OIF,SLRR3A |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGAAGACTCTGCAGTCTACACTTCTCCTGTTACTGCTTGTGCCTCTGATAAAGCCAGCACCACCAACCCAGCAGGACTCACGCATTATCTATGATTATGGAACAGATAATTTTGAAGAATCCATATTTAGCCAAGATTATGAGGATAAATACCTGGATGGAAAAAATATTAAGGAAAAAGAAACTGTGATAATACCCAATGAGAAAAGTCTTCAATTACAAAAAGATGAGGCAATAACACCATTACCTCCCAAGAAAGAAAATGATGAAATGCCCACGTGTCTGCTGTGTGTTTGTTTAAGTGGCTCTGTATACTGTGAAGAAGTTGACATTGATGCTGTACCACCCTTACCAAAGGAATCAGCCTATCTTTACGCACGATTCAACAAAATTAAAAAGCTGACTGCCAAAGATTTTGCAGACATACCTAACTTAAGAAGACTCGATTTTACAGGAAATTTGATAGAAGATATAGAAGATGGTACTTTTTCAAAACTTTCTCTGTTAGAAGAACTTTCACTTGCTGAAAATCAACTACTAAAACTTCCAGTTCTTCCTCCCAAGCTCACTTTATTTAATGCAAAATACAACAAAATCAAGAGTAGGGGAATCAAAGCAAATGCATTCAAAAAACTGAATAACCTCACCTTCCTCTACTTGGACCATAATGCCCTGGAATCCGTGCCTCTTAATTTACCAGAAAGTCTACGTGTAATTCATCTTCAGTTCAACAACATAGCTTCAATTACAGATGACACATTCTGCAAGGCTAATGACACCAGTTACATCCGGGACCGCATTGAAGAGATACGCCTGGAGGGCAATCCAATCGTCCTGGGAAAGCATCCAAACAGTTTTATTTGCTTAAAAAGATTACCGATAGGGTCATACTTTTAA |
| ORF Protein Sequence | MKTLQSTLLLLLLVPLIKPAPPTQQDSRIIYDYGTDNFEESIFSQDYEDKYLDGKNIKEKETVIIPNEKSLQLQKDEAITPLPPKKENDEMPTCLLCVCLSGSVYCEEVDIDAVPPLPKESAYLYARFNKIKKLTAKDFADIPNLRRLDFTGNLIEDIEDGTFSKLSLLEELSLAENQLLKLPVLPPKLTLFNAKYNKIKSRGIKANAFKKLNNLTFLYLDHNALESVPLNLPESLRVIHLQFNNIASITDDTFCKANDTSYIRDRIEEIRLEGNPIVLGKHPNSFICLKRLPIGSYF |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-SE0384-Ab | Anti-MIME/ OGN/ OG functional antibody |
| Target Antigen | GM-Tg-g-SE0384-Ag | OGN protein |
| ORF Viral Vector | pGMLV002694 | Human OGN Lentivirus plasmid |
| ORF Viral Vector | pGMAP000452 | Human OGN Adenovirus plasmid |
| ORF Viral Vector | pGMPC001835 | Human OGN Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | vGMLV002694 | Human OGN Lentivirus particle |
| ORF Viral Vector | vGMAP000452 | Human OGN Adenovirus particle |
Target information
| Target ID | GM-SE0384 |
| Target Name | OGN |
| Gene ID | 4969, 18295, 706168, 291015, 102899607, 610704, 280884, 100054772 |
| Gene Symbol and Synonyms | 3110079A16Rik,mimecan,mimican,OG,OGN,OIF,SLRR3A |
| Uniprot Accession | P20774 |
| Uniprot Entry Name | MIME_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000106809 |
| Target Classification | Not Available |
This gene encodes a member of the small leucine-rich proteoglycan (SLRP) family of proteins. The encoded protein induces ectopic bone formation in conjunction with transforming growth factor beta and may regulate osteoblast differentiation. High expression of the encoded protein may be associated with elevated heart left ventricular mass. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


