Human OGN/DKFZP586P2421/OIF ORF/cDNA clone-Adenovirus particle (BC037273)

Cat. No.: vGMAP000452

Pre-made Human OGN/DKFZP586P2421/OIF Adenovirus for OGN overexpression in-vitro and in-vivo. The OGN adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified OGN-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to OGN/DKFZP586P2421 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000452 Human OGN Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000452
Gene Name OGN
Accession Number BC037273
Gene ID 4969
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 897 bp
Gene Alias DKFZP586P2421,OIF,SLRR3A
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGAAGACTCTGCAGTCTACACTTCTCCTGTTACTGCTTGTGCCTCTGATAAAGCCAGCACCACCAACCCAGCAGGACTCACGCATTATCTATGATTATGGAACAGATAATTTTGAAGAATCCATATTTAGCCAAGATTATGAGGATAAATACCTGGATGGAAAAAATATTAAGGAAAAAGAAACTGTGATAATACCCAATGAGAAAAGTCTTCAATTACAAAAAGATGAGGCAATAACACCATTACCTCCCAAGAAAGAAAATGATGAAATGCCCACGTGTCTGCTGTGTGTTTGTTTAAGTGGCTCTGTATACTGTGAAGAAGTTGACATTGATGCTGTACCACCCTTACCAAAGGAATCAGCCTATCTTTACGCACGATTCAACAAAATTAAAAAGCTGACTGCCAAAGATTTTGCAGACATACCTAACTTAAGAAGACTCGATTTTACAGGAAATTTGATAGAAGATATAGAAGATGGTACTTTTTCAAAACTTTCTCTGTTAGAAGAACTTTCACTTGCTGAAAATCAACTACTAAAACTTCCAGTTCTTCCTCCCAAGCTCACTTTATTTAATGCAAAATACAACAAAATCAAGAGTAGGGGAATCAAAGCAAATGCATTCAAAAAACTGAATAACCTCACCTTCCTCTACTTGGACCATAATGCCCTGGAATCCGTGCCTCTTAATTTACCAGAAAGTCTACGTGTAATTCATCTTCAGTTCAACAACATAGCTTCAATTACAGATGACACATTCTGCAAGGCTAATGACACCAGTTACATCCGGGACCGCATTGAAGAGATACGCCTGGAGGGCAATCCAATCGTCCTGGGAAAGCATCCAAACAGTTTTATTTGCTTAAAAAGATTACCGATAGGGTCATACTTTTAA
ORF Protein Sequence MKTLQSTLLLLLLVPLIKPAPPTQQDSRIIYDYGTDNFEESIFSQDYEDKYLDGKNIKEKETVIIPNEKSLQLQKDEAITPLPPKKENDEMPTCLLCVCLSGSVYCEEVDIDAVPPLPKESAYLYARFNKIKKLTAKDFADIPNLRRLDFTGNLIEDIEDGTFSKLSLLEELSLAENQLLKLPVLPPKLTLFNAKYNKIKSRGIKANAFKKLNNLTFLYLDHNALESVPLNLPESLRVIHLQFNNIASITDDTFCKANDTSYIRDRIEEIRLEGNPIVLGKHPNSFICLKRLPIGSYF

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0384-Ab Anti-MIME/ OGN/ OG functional antibody
    Target Antigen GM-Tg-g-SE0384-Ag OGN protein
    ORF Viral Vector pGMLV002694 Human OGN Lentivirus plasmid
    ORF Viral Vector pGMAP000452 Human OGN Adenovirus plasmid
    ORF Viral Vector pGMPC001835 Human OGN Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV002694 Human OGN Lentivirus particle
    ORF Viral Vector vGMAP000452 Human OGN Adenovirus particle


    Target information

    Target ID GM-SE0384
    Target Name OGN
    Gene ID 4969, 18295, 706168, 291015, 102899607, 610704, 280884, 100054772
    Gene Symbol and Synonyms 3110079A16Rik,mimecan,mimican,OG,OGN,OIF,SLRR3A
    Uniprot Accession P20774
    Uniprot Entry Name MIME_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000106809
    Target Classification Not Available

    This gene encodes a member of the small leucine-rich proteoglycan (SLRP) family of proteins. The encoded protein induces ectopic bone formation in conjunction with transforming growth factor beta and may regulate osteoblast differentiation. High expression of the encoded protein may be associated with elevated heart left ventricular mass. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.