Human BNIP3L/BNIP3a/NIX ORF/cDNA clone-Adenovirus particle (NM_004331)
Cat. No.: vGMAP-SPh-257
Pre-made Human BNIP3L/BNIP3a/NIX Adenovirus for BNIP3L overexpression in-vitro and in-vivo. The BNIP3L adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified BNIP3L-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
BNIP3L/BNIP3a products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAP-SPh-257 | Human BNIP3L Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAP-SPh-257 |
| Gene Name | BNIP3L |
| Accession Number | NM_004331 |
| Gene ID | 665 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 660 bp |
| Gene Alias | BNIP3a,NIX |
| Fluorescent Reporter | EGFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGTCGTCCCACCTAGTCGAGCCGCCGCCGCCCCTGCACAACAACAACAACAACTGCGAGGAAAATGAGCAGTCTCTGCCCCCGCCGGCCGGCCTCAACAGTTCCTGGGTGGAGCTACCCATGAACAGCAGCAATGGCAATGATAATGGCAATGGGAAAAATGGGGGGCTGGAACACGTACCATCCTCATCCTCCATCCACAATGGAGACATGGAGAAGATTCTTTTGGATGCACAACATGAATCAGGACAGAGTAGTTCCAGAGGCAGTTCTCACTGTGACAGCCCTTCGCCACAAGAAGATGGGCAGATCATGTTTGATGTGGAAATGCACACCAGCAGGGACCATAGCTCTCAGTCAGAAGAAGAAGTTGTAGAAGGAGAGAAGGAAGTCGAGGCTTTGAAGAAAAGTGCGGACTGGGTATCAGACTGGTCCAGTAGACCCGAAAACATTCCACCCAAGGAGTTCCACTTCAGACACCCTAAACGTTCTGTGTCTTTAAGCATGAGGAAAAGTGGAGCCATGAAGAAAGGGGGTATTTTCTCCGCAGAATTTCTGAAGGTGTTCATTCCATCTCTCTTCCTTTCTCATGTTTTGGCTTTGGGGCTAGGCATCTATATTGGAAAGCGACTGAGCACACCCTCTGCCAGCACCTACTGA |
| ORF Protein Sequence | MSSHLVEPPPPLHNNNNNCEENEQSLPPPAGLNSSWVELPMNSSNGNDNGNGKNGGLEHVPSSSSIHNGDMEKILLDAQHESGQSSSRGSSHCDSPSPQEDGQIMFDVEMHTSRDHSSQSEEEVVEGEKEVEALKKSADWVSDWSSRPENIPPKEFHFRHPKRSVSLSMRKSGAMKKGGIFSAEFLKVFIPSLFLSHVLALGLGIYIGKRLSTPSASTY |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-IP0427-Ab | Anti-BNIP3L monoclonal antibody |
| Target Antigen | GM-Tg-g-IP0427-Ag | BNIP3L protein |
| ORF Viral Vector | pGMLP000351 | Human BNIP3L Lentivirus plasmid |
| ORF Viral Vector | pGMLP-SPh-117 | Human BNIP3L Lentivirus plasmid |
| ORF Viral Vector | pGMAP-SPh-257 | Human BNIP3L Adenovirus plasmid |
| ORF Viral Vector | pGMPC000336 | Human BNIP3L Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | vGMLP000351 | Human BNIP3L Lentivirus particle |
| ORF Viral Vector | vGMLP-SPh-117 | Human BNIP3L Lentivirus particle |
| ORF Viral Vector | vGMAP-SPh-257 | Human BNIP3L Adenovirus particle |
Target information
| Target ID | GM-IP0427 |
| Target Name | BNIP3L |
| Gene ID | 665, 12177, 641440, 140923, 101099293, 608552, 534615, 100054317 |
| Gene Symbol and Synonyms | BNIP3a,BNIP3L,D14Ertd719e,Nip3L,NIX,UV93 |
| Uniprot Accession | O60238 |
| Uniprot Entry Name | BNI3L_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Not Available |
| Disease | Cancer |
| Gene Ensembl | ENSG00000104765 |
| Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a protein that belongs to the pro-apoptotic subfamily within the Bcl-2 family of proteins. The encoded protein binds to Bcl-2 and possesses the BH3 domain. The protein directly targets mitochondria and causes apoptotic changes, including loss of membrane potential and the release of cytochrome c. [provided by RefSeq, Feb 2015]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


