Human BNIP3L/BNIP3a/NIX ORF/cDNA clone-Lentivirus particle (NM_004331)

Cat. No.: vGMLP000351

Pre-made Human BNIP3L/BNIP3a/NIX Lentiviral expression plasmid for BNIP3L lentivirus packaging, BNIP3L lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to BNIP3L/BNIP3a products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000351 Human BNIP3L Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000351
Gene Name BNIP3L
Accession Number NM_004331
Gene ID 665
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 660 bp
Gene Alias BNIP3a,NIX
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCGTCCCACCTAGTCGAGCCGCCGCCGCCCCTGCACAACAACAACAACAACTGCGAGGAAAATGAGCAGTCTCTGCCCCCGCCGGCCGGCCTCAACAGTTCCTGGGTGGAGCTACCCATGAACAGCAGCAATGGCAATGATAATGGCAATGGGAAAAATGGGGGGCTGGAACACGTACCATCCTCATCCTCCATCCACAATGGAGACATGGAGAAGATTCTTTTGGATGCACAACATGAATCAGGACAGAGTAGTTCCAGAGGCAGTTCTCACTGTGACAGCCCTTCGCCACAAGAAGATGGGCAGATCATGTTTGATGTGGAAATGCACACCAGCAGGGACCATAGCTCTCAGTCAGAAGAAGAAGTTGTAGAAGGAGAGAAGGAAGTCGAGGCTTTGAAGAAAAGTGCGGACTGGGTATCAGACTGGTCCAGTAGACCCGAAAACATTCCACCCAAGGAGTTCCACTTCAGACACCCTAAACGTTCTGTGTCTTTAAGCATGAGGAAAAGTGGAGCCATGAAGAAAGGGGGTATTTTCTCCGCAGAATTTCTGAAGGTGTTCATTCCATCTCTCTTCCTTTCTCATGTTTTGGCTTTGGGGCTAGGCATCTATATTGGAAAGCGACTGAGCACACCCTCTGCCAGCACCTACTGA
ORF Protein Sequence MSSHLVEPPPPLHNNNNNCEENEQSLPPPAGLNSSWVELPMNSSNGNDNGNGKNGGLEHVPSSSSIHNGDMEKILLDAQHESGQSSSRGSSHCDSPSPQEDGQIMFDVEMHTSRDHSSQSEEEVVEGEKEVEALKKSADWVSDWSSRPENIPPKEFHFRHPKRSVSLSMRKSGAMKKGGIFSAEFLKVFIPSLFLSHVLALGLGIYIGKRLSTPSASTY

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0427-Ab Anti-BNIP3L monoclonal antibody
    Target Antigen GM-Tg-g-IP0427-Ag BNIP3L protein
    ORF Viral Vector pGMLP000351 Human BNIP3L Lentivirus plasmid
    ORF Viral Vector pGMLP-SPh-117 Human BNIP3L Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-257 Human BNIP3L Adenovirus plasmid
    ORF Viral Vector pGMPC000336 Human BNIP3L Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP000351 Human BNIP3L Lentivirus particle
    ORF Viral Vector vGMLP-SPh-117 Human BNIP3L Lentivirus particle
    ORF Viral Vector vGMAP-SPh-257 Human BNIP3L Adenovirus particle


    Target information

    Target ID GM-IP0427
    Target Name BNIP3L
    Gene ID 665, 12177, 641440, 140923, 101099293, 608552, 534615, 100054317
    Gene Symbol and Synonyms BNIP3a,BNIP3L,D14Ertd719e,Nip3L,NIX,UV93
    Uniprot Accession O60238
    Uniprot Entry Name BNI3L_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Cancer
    Gene Ensembl ENSG00000104765
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a protein that belongs to the pro-apoptotic subfamily within the Bcl-2 family of proteins. The encoded protein binds to Bcl-2 and possesses the BH3 domain. The protein directly targets mitochondria and causes apoptotic changes, including loss of membrane potential and the release of cytochrome c. [provided by RefSeq, Feb 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.