Human IL1B/IL-1/ IL1-BETA ORF/cDNA clone-Adenovirus particle (BC008678)

Pre-made Human IL1B/IL-1/ IL1-BETA Adenovirus for IL1B overexpression in-vitro and in-vivo. The IL1B adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified IL1B-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to IL1B/IL-1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000158 Human IL1B Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000158
Gene Name IL1B
Accession Number BC008678
Gene ID 3553
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 810 bp
Gene Alias IL-1, IL1-BETA, IL1F2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCAGAAGTACCTGAGCTCGCCAGTGAAATGATGGCTTATTACAGTGGCAATGAGGATGACTTGTTCTTTGAAGCTGATGGCCCTAAACAGATGAAGTGCTCCTTCCAGGACCTGGACCTCTGCCCTCTGGATGGCGGCATCCAGCTACGAATCTCCGACCACCACTACAGCAAGGGCTTCAGGCAGGCCGCGTCAGTTGTTGTGGCCATGGACAAGCTGAGGAAGATGCTGGTTCCCTGCCCACAGACCTTCCAGGAGAATGACCTGAGCACCTTCTTTCCCTTCATCTTTGAAGAAGAACCTATCTTCTTCGACACATGGGATAACGAGGCTTATGTGCACGATGCACCTGTACGATCACTGAACTGCACGCTCCGGGACTCACAGCAAAAAAGCTTGGTGATGTCTGGTCCATATGAACTGAAAGCTCTCCACCTCCAGGGACAGGATATGGAGCAACAAGTGGTGTTCTCCATGTCCTTTGTACAAGGAGAAGAAAGTAATGACAAAATACCTGTGGCCTTGGGCCTCAAGGAAAAGAATCTGTACCTGTCCTGCGTGTTGAAAGATGATAAGCCCACTCTACAGCTGGAGAGTGTAGATCCCAAAAATTACCCAAAGAAGAAGATGGAAAAGCGATTTGTCTTCAACAAGATAGAAATCAATAACAAGCTGGAATTTGAGTCTGCCCAGTTCCCCAACTGGTACATCAGCACCTCTCAAGCAGAAAACATGCCCGTCTTCCTGGGAGGGACCAAAGGCGGCCAGGATATAACTGACTTCACCATGCAATTTGTGTCTTCCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-241 Pre-Made Gevokizumab biosimilar, Whole mAb, Anti-IL1B Antibody: Anti-IL-1/IL1-BETA/IL1F2/IL1beta therapeutic antibody
    Biosimilar GMP-Bios-ab-091 Pre-Made Canakinumab biosimilar, Whole mAb, Anti-IL1B Antibody: Anti-IL-1/IL1-BETA/IL1F2/IL1beta therapeutic antibody
    Biosimilar GMP-Bios-INN-973 Pre-Made Rilonacept Biosimilar, Fusion Protein targeting IL1B fused with human IGHG1 Fc (Fragment constant): Recombinant therapeutic protein targeting IL-1/IL1-BETA/IL1F2/IL1beta
    Biosimilar GMP-Bios-ab-331 Pre-Made Lutikizumab biosimilar, Bispecific Dual Variable Domain IG, Anti-IL1A;IL1B Antibody: Anti-IL1/IL-1A/IL1F1/IL1-ALPHA/IL-1 alpha;IL-1/IL1-BETA/IL1F2/IL1beta therapeutic antibody
    Target Antibody GM-Tg-g-T42000-Ab Anti-IL1B/ IL-1/ IL1-BETA functional antibody
    Target Antigen GM-Tg-g-T42000-Ag IL1B protein
    Cytokine cks-Tg-g-GM-T42000 Interleukin-1 Beta (Il1b) protein & antibody
    ORF Viral Vector pGMAD000735 Human IL1B Adenovirus plasmid
    ORF Viral Vector pGMAP000158 Human IL1B Adenovirus plasmid
    ORF Viral Vector pGMLP-IL-002 Human IL1B Lentivirus plasmid
    ORF Viral Vector pGMAP-IL-085 Human IL1B Adenovirus plasmid
    ORF Viral Vector vGMAD000735 Human IL1B Adenovirus particle
    ORF Viral Vector vGMAP000158 Human IL1B Adenovirus particle
    ORF Viral Vector vGMLP-IL-002 Human IL1B Lentivirus particle
    ORF Viral Vector vGMAP-IL-085 Human IL1B Adenovirus particle


    Target information

    Target ID GM-T42000
    Target Name IL1B
    Gene ID 3553, 16176, 704701, 24494, 768274, 403974, 281251
    Gene Symbol and Synonyms IL-1,Il-1b,IL-1beta,IL-1F2,IL1-BETA,IL1B,IL1beta,IL1F2
    Uniprot Accession P01584
    Uniprot Entry Name IL1B_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target
    Disease Breast Cancer, prostate cancer
    Gene Ensembl ENSG00000125538
    Target Classification Checkpoint-Immuno Oncology

    The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine is produced by activated macrophages as a proprotein, which is proteolytically processed to its active form by caspase 1 (CASP1/ICE). This cytokine is an important mediator of the inflammatory response, and is involved in a variety of cellular activities, including cell proliferation, differentiation, and apoptosis. The induction of cyclooxygenase-2 (PTGS2/COX2) by this cytokine in the central nervous system (CNS) is found to contribute to inflammatory pain hypersensitivity. Similarly, IL-1B has been implicated in human osteoarthritis pathogenesis. Patients with severe Coronavirus Disease 2019 (COVID-19) present elevated levels of pro-inflammatory cytokines such as IL-1B in bronchial alveolar lavage fluid samples. The lung damage induced by the Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is to a large extent, a result of the inflammatory response promoted by cytokines such as IL-1B. This gene and eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. [provided by RefSeq, Jul 2020]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.