Human NF2/ACN/ BANF ORF/cDNA clone-Adenovirus particle (BC003112)

Pre-made Human NF2/ACN/ BANF Adenovirus for NF2 overexpression in-vitro and in-vivo. The NF2 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified NF2-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to NF2/ACN products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000183 Human NF2 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000183
Gene Name NF2
Accession Number BC003112
Gene ID 4771
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1524 bp
Gene Alias ACN, BANF, SCH
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCCGGGGCCATCGCTTCCCGCATGAGCTTCAGCTCTCTCAAGAGGAAGCAACCCAAGACGTTCACCGTGAGGATCGTCACCATGGACGCCGAGATGGAGTTCAATTGCGAGGTAAAGAAGCAGATTTTAGATGAAAAGATCTACTGCCCTCCTGAGGCTTCTGTGCTCCTGGCTTCTTACGCCGTCCAGGCCAAGTATGGTGACTACGACCCCAGTGTTCACAAGCGGGGATTTTTGGCCCAAGAGGAATTGCTTCCAAAAAGGGTAATAAATCTGTATCAGATGACTCCGGAAATGTGGGAGGAGAGAATTACTGCTTGGTACGCAGAGCACCGAGGCCGAGCCAGGGATGAAGCTGAAATGGAATATCTGAAGATAGCTCAGGACCTGGAGATGTACGGTGTGAACTACTTTGCAATCCGGAATAAAAAGGGCACAGAGCTGCTGCTTGGAGTGGATGCCCTGGGGCTTCACATTTATGACCCTGAGAACAGACTGACCCCCAAGATCTCCTTCCCGTGGAATGAAATCCGAAACATCTCGTACAGTGACAAGGAGTTTACTATTAAACCACTGGATAAGAAAATTGATGTCTTCAAGTTTAACTCCTCAAAGCTTCGTGTTAATAAGCTGATTCTCCAGCTATGTATCGGGAACCATGATCTATTTATGAGGAGAAGGAAAGCCGATTCTTTGGAAGTTCAGCAGATGAAAGCCCAGGCCAGGGAGGAGAAGGCTAGAAAGCAGATGGAGCGGCAGCGCCTCGCTCGAGAGAAGCAGATGAGGGAGGAGGCTGAACGCACGAGGGATGAGTTGGAGAGGAGGCTGCTGCAGATGAAAGAAGAAGCAACAATGGCCAACGAAGCACTGATGCGGTCTGAGGAGACAGCTGACCTGTTGGCTGAAAAGGCCCAGATCACCGAGGAGGAGGCAAAACTTCTGGCCCAGAAGGCCGCAGAGGCTGAGCAGGAAATGCAGCGCATCAAGGCCACAGCGATTCGCACGGAGGAGGAGAAGCGCCTGATGGAGCAGAAGGTGCTGGAAGCCGAGGTGCTGGCACTGAAGATGGCTGAGGAGTCAGAGAGGAGGGCCAAAGAGGCAGATCAGCTGAAGCAGGACCTGCAGGAAGCACGCGAGGCGGAGCGAAGAGCCAAGCAGAAGCTCCTGGAGATTGCCACCAAGCCCACGTACCCGCCCATGAACCCAATTCCAGCACCGTTGCCTCCTGACATACCAAGCTTCAACCTCATTGGTGACAGCCTGTCTTTCGACTTCAAAGATACTGACATGAAGCGGCTTTCCATGGAGATAGAGAAAGAAAAAGTGGAATACATGGAAAAGAGCAAGCATCTGCAGGAGCAGCTCAATGAACTCAAGACAGAAATCGAGGCCTTGAAACTGAAAGAGAGGGAGACAGCTCTGGATATTCTGCACAATGAGAACTCCGACAGGGGTGGCAGCAGCAAGCACAATACCATTAAAAAGCCTCAAGCCCAAGGCAGAAGACCTATCTGCATTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T95742-Ab Anti-MERL/ NF2/ ACN monoclonal antibody
    Target Antigen GM-Tg-g-T95742-Ag NF2 VLP (virus-like particle)
    ORF Viral Vector pGMAAV000184 Rat Nf2 Adeno-associate virus(AAV) plasmid
    ORF Viral Vector pGMAP000183 Human NF2 Adenovirus plasmid
    ORF Viral Vector vGMAAV000184 Rat Nf2 Adeno-associate virus(AAV) particle
    ORF Viral Vector vGMAP000183 Human NF2 Adenovirus particle
    ORF Viral Vector pGMLV002456 Human NF2 Lentivirus plasmid


    Target information

    Target ID GM-T95742
    Target Name NF2
    Gene ID 4771, 18016, 714945, 25744, 101087787, 477535, 540479, 100058977
    Gene Symbol and Synonyms ACN,BANF,merlin,merlin-1,NF2,SCH,SWNV
    Uniprot Accession P35240
    Uniprot Entry Name MERL_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000186575
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a protein that is similar to some members of the ERM (ezrin, radixin, moesin) family of proteins that link cytoskeletal components with proteins in the cell membrane. The encoded protein is involved in regulation of contact-dependent inhibition of cell proliferation and functions in cell-cell adhesion and transmembrane signaling. The encoded protein has been shown to interact with cell-surface proteins, proteins involved in cytoskeletal dynamics, and proteins involved in regulating ion transport. Disruption of this protein's function has been implicated in tumorigenesis and metastasis. Mutations in this gene are associated with neurofibromatosis type II which is characterized by nervous system and skin tumors and ocular abnormalities. [provided by RefSeq, May 2022]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.