Human NF2/ACN/ BANF ORF/cDNA clone-Adenovirus particle (BC003112)
Pre-made Human NF2/ACN/ BANF Adenovirus for NF2 overexpression in-vitro and in-vivo. The NF2 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified NF2-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to NF2/ACN products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000183 | Human NF2 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000183 |
Gene Name | NF2 |
Accession Number | BC003112 |
Gene ID | 4771 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 1524 bp |
Gene Alias | ACN, BANF, SCH |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCCGGGGCCATCGCTTCCCGCATGAGCTTCAGCTCTCTCAAGAGGAAGCAACCCAAGACGTTCACCGTGAGGATCGTCACCATGGACGCCGAGATGGAGTTCAATTGCGAGGTAAAGAAGCAGATTTTAGATGAAAAGATCTACTGCCCTCCTGAGGCTTCTGTGCTCCTGGCTTCTTACGCCGTCCAGGCCAAGTATGGTGACTACGACCCCAGTGTTCACAAGCGGGGATTTTTGGCCCAAGAGGAATTGCTTCCAAAAAGGGTAATAAATCTGTATCAGATGACTCCGGAAATGTGGGAGGAGAGAATTACTGCTTGGTACGCAGAGCACCGAGGCCGAGCCAGGGATGAAGCTGAAATGGAATATCTGAAGATAGCTCAGGACCTGGAGATGTACGGTGTGAACTACTTTGCAATCCGGAATAAAAAGGGCACAGAGCTGCTGCTTGGAGTGGATGCCCTGGGGCTTCACATTTATGACCCTGAGAACAGACTGACCCCCAAGATCTCCTTCCCGTGGAATGAAATCCGAAACATCTCGTACAGTGACAAGGAGTTTACTATTAAACCACTGGATAAGAAAATTGATGTCTTCAAGTTTAACTCCTCAAAGCTTCGTGTTAATAAGCTGATTCTCCAGCTATGTATCGGGAACCATGATCTATTTATGAGGAGAAGGAAAGCCGATTCTTTGGAAGTTCAGCAGATGAAAGCCCAGGCCAGGGAGGAGAAGGCTAGAAAGCAGATGGAGCGGCAGCGCCTCGCTCGAGAGAAGCAGATGAGGGAGGAGGCTGAACGCACGAGGGATGAGTTGGAGAGGAGGCTGCTGCAGATGAAAGAAGAAGCAACAATGGCCAACGAAGCACTGATGCGGTCTGAGGAGACAGCTGACCTGTTGGCTGAAAAGGCCCAGATCACCGAGGAGGAGGCAAAACTTCTGGCCCAGAAGGCCGCAGAGGCTGAGCAGGAAATGCAGCGCATCAAGGCCACAGCGATTCGCACGGAGGAGGAGAAGCGCCTGATGGAGCAGAAGGTGCTGGAAGCCGAGGTGCTGGCACTGAAGATGGCTGAGGAGTCAGAGAGGAGGGCCAAAGAGGCAGATCAGCTGAAGCAGGACCTGCAGGAAGCACGCGAGGCGGAGCGAAGAGCCAAGCAGAAGCTCCTGGAGATTGCCACCAAGCCCACGTACCCGCCCATGAACCCAATTCCAGCACCGTTGCCTCCTGACATACCAAGCTTCAACCTCATTGGTGACAGCCTGTCTTTCGACTTCAAAGATACTGACATGAAGCGGCTTTCCATGGAGATAGAGAAAGAAAAAGTGGAATACATGGAAAAGAGCAAGCATCTGCAGGAGCAGCTCAATGAACTCAAGACAGAAATCGAGGCCTTGAAACTGAAAGAGAGGGAGACAGCTCTGGATATTCTGCACAATGAGAACTCCGACAGGGGTGGCAGCAGCAAGCACAATACCATTAAAAAGCCTCAAGCCCAAGGCAGAAGACCTATCTGCATTTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T95742-Ab | Anti-MERL/ NF2/ ACN monoclonal antibody |
Target Antigen | GM-Tg-g-T95742-Ag | NF2 VLP (virus-like particle) |
ORF Viral Vector | pGMAAV000184 | Rat Nf2 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMAP000183 | Human NF2 Adenovirus plasmid |
ORF Viral Vector | vGMAAV000184 | Rat Nf2 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMAP000183 | Human NF2 Adenovirus particle |
ORF Viral Vector | pGMLV002456 | Human NF2 Lentivirus plasmid |
Target information
Target ID | GM-T95742 |
Target Name | NF2 |
Gene ID | 4771, 18016, 714945, 25744, 101087787, 477535, 540479, 100058977 |
Gene Symbol and Synonyms | ACN,BANF,merlin,merlin-1,NF2,SCH,SWNV |
Uniprot Accession | P35240 |
Uniprot Entry Name | MERL_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000186575 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a protein that is similar to some members of the ERM (ezrin, radixin, moesin) family of proteins that link cytoskeletal components with proteins in the cell membrane. The encoded protein is involved in regulation of contact-dependent inhibition of cell proliferation and functions in cell-cell adhesion and transmembrane signaling. The encoded protein has been shown to interact with cell-surface proteins, proteins involved in cytoskeletal dynamics, and proteins involved in regulating ion transport. Disruption of this protein's function has been implicated in tumorigenesis and metastasis. Mutations in this gene are associated with neurofibromatosis type II which is characterized by nervous system and skin tumors and ocular abnormalities. [provided by RefSeq, May 2022]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.