Human MBP ORF/cDNA clone-Adenovirus particle (BC065248)
Pre-made Human MBP/ Adenovirus for MBP overexpression in-vitro and in-vivo. The MBP adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified MBP-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to MBP/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000256 | Human MBP Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000256 |
Gene Name | MBP |
Accession Number | BC065248 |
Gene ID | 4155 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 594 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGAAACCACGCAGGCAAACGAGAATTAAATGCCGAGAAGGCCAGTACGAATAGTGAAACTAACAGAGGAGAATCTGAAAAAAAGAGAAACCTGGGTGAACTTTCACGGACAACCTCAGAGGACAACGAAGTGTTCGGAGAGGCAGATGCGAACCAGAACAATGGGACCTCCTCTCAGGACACAGCGGTGACTGACTCCAAGCGCACAGCGGACCCGAAGAATGCCTGGCAGGATGCCCACCCAGCTGACCCAGGGAGCCGCCCCCACTTGATCCGCCTCTTTTCCCGAGATGCCCCGGGGAGGGAGGACAACACCTTCAAAGACAGGCCCTCTGAGTCCGACGAGCTCCAGACCATCCAAGAAGACAGTGCAGCCACCTCCGAGAGCCTGGATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCCAAGTACCTGGCCACAGCAAGTACCATGGACCATGCCAGGCATGGCTTCCTCCCAAGGCACAGAGACACGGGCATCCTTGACTCCATCGGGCGCTTCTTTGGCGGTGACAGGGGTGCGCCCAAGCGGGGCTCTGGCAAGGTGAGCTCTGAGGAGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T54761-Ab | Anti-MBP monoclonal antibody |
Target Antigen | GM-Tg-g-T54761-Ag | MBP VLP (virus-like particle) |
ORF Viral Vector | pGMLP000535 | Human MBP Lentivirus plasmid |
ORF Viral Vector | pGMAP000256 | Human MBP Adenovirus plasmid |
ORF Viral Vector | vGMLP000535 | Human MBP Lentivirus particle |
ORF Viral Vector | vGMAP000256 | Human MBP Adenovirus particle |
Target information
Target ID | GM-T54761 |
Target Name | MBP |
Gene ID | 4155, 17196, 710350, 24547, 101096421, 476160, 618684, 100063306 |
Gene Symbol and Synonyms | golli-mbp,Hmbpr,jve,MBP,Mbps,mld,shi |
Uniprot Accession | P02686 |
Uniprot Entry Name | MBP_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Neuromuscular function, subclinical astrogliosis |
Gene Ensembl | ENSG00000197971 |
Target Classification | Not Available |
Note: MBP (Gene ID: 4155) and MBL2 (Gene ID: 4153) share the MBP symbol/alias in common. MBP is a widely used alternative name for mannose binding lectin 2 (MBL2), which can be confused with the official symbol for MBP (myelin basic protein, GeneID 4155). [01 Jun 2018]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.