Human MBP ORF/cDNA clone-Adenovirus particle (BC065248)

Pre-made Human MBP/ Adenovirus for MBP overexpression in-vitro and in-vivo. The MBP adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified MBP-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to MBP/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000256 Human MBP Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000256
Gene Name MBP
Accession Number BC065248
Gene ID 4155
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 594 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGAAACCACGCAGGCAAACGAGAATTAAATGCCGAGAAGGCCAGTACGAATAGTGAAACTAACAGAGGAGAATCTGAAAAAAAGAGAAACCTGGGTGAACTTTCACGGACAACCTCAGAGGACAACGAAGTGTTCGGAGAGGCAGATGCGAACCAGAACAATGGGACCTCCTCTCAGGACACAGCGGTGACTGACTCCAAGCGCACAGCGGACCCGAAGAATGCCTGGCAGGATGCCCACCCAGCTGACCCAGGGAGCCGCCCCCACTTGATCCGCCTCTTTTCCCGAGATGCCCCGGGGAGGGAGGACAACACCTTCAAAGACAGGCCCTCTGAGTCCGACGAGCTCCAGACCATCCAAGAAGACAGTGCAGCCACCTCCGAGAGCCTGGATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCCAAGTACCTGGCCACAGCAAGTACCATGGACCATGCCAGGCATGGCTTCCTCCCAAGGCACAGAGACACGGGCATCCTTGACTCCATCGGGCGCTTCTTTGGCGGTGACAGGGGTGCGCCCAAGCGGGGCTCTGGCAAGGTGAGCTCTGAGGAGTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T54761-Ab Anti-MBP monoclonal antibody
    Target Antigen GM-Tg-g-T54761-Ag MBP VLP (virus-like particle)
    ORF Viral Vector pGMLP000535 Human MBP Lentivirus plasmid
    ORF Viral Vector pGMAP000256 Human MBP Adenovirus plasmid
    ORF Viral Vector vGMLP000535 Human MBP Lentivirus particle
    ORF Viral Vector vGMAP000256 Human MBP Adenovirus particle


    Target information

    Target ID GM-T54761
    Target Name MBP
    Gene ID 4155, 17196, 710350, 24547, 101096421, 476160, 618684, 100063306
    Gene Symbol and Synonyms golli-mbp,Hmbpr,jve,MBP,Mbps,mld,shi
    Uniprot Accession P02686
    Uniprot Entry Name MBP_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Neuromuscular function, subclinical astrogliosis
    Gene Ensembl ENSG00000197971
    Target Classification Not Available

    Note: MBP (Gene ID: 4155) and MBL2 (Gene ID: 4153) share the MBP symbol/alias in common. MBP is a widely used alternative name for mannose binding lectin 2 (MBL2), which can be confused with the official symbol for MBP (myelin basic protein, GeneID 4155). [01 Jun 2018]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.