Human MBP ORF/cDNA clone-Lentivirus particle (NM_001025100)
Pre-made Human MBP/ Lentiviral expression plasmid for MBP lentivirus packaging, MBP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to MBP/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP000535 | Human MBP Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP000535 |
Gene Name | MBP |
Accession Number | NM_001025100 |
Gene ID | 4155 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 594 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGAAACCACGCAGGCAAACGAGAATTAAATGCCGAGAAGGCCAGTACGAATAGTGAAACTAACAGAGGAGAATCTGAAAAAAAGAGAAACCTGGGTGAACTTTCACGGACAACCTCAGAGGACAACGAAGTGTTCGGAGAGGCAGATGCGAACCAGAACAATGGGACCTCCTCTCAGGACACAGCGGTGACTGACTCCAAGCGCACAGCGGACCCGAAGAATGCCTGGCAGGATGCCCACCCAGCTGACCCAGGGAGCCGCCCCCACTTGATCCGCCTCTTTTCCCGAGATGCCCCGGGGAGGGAGGACAACACCTTCAAAGACAGGCCCTCTGAGTCCGACGAGCTCCAGACCATCCAAGAAGACAGTGCAGCCACCTCCGAGAGCCTGGATGTGATGGCGTCACAGAAGAGACCCTCCCAGAGGCACGGATCCAAGTACCTGGCCACAGCAAGTACCATGGACCATGCCAGGCATGGCTTCCTCCCAAGGCACAGAGACACGGGCATCCTTGACTCCATCGGGCGCTTCTTTGGCGGTGACAGGGGTGCGCCCAAGCGGGGCTCTGGCAAGGTGAGCTCTGAGGAGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T54761-Ab | Anti-MBP monoclonal antibody |
Target Antigen | GM-Tg-g-T54761-Ag | MBP VLP (virus-like particle) |
ORF Viral Vector | pGMLP000535 | Human MBP Lentivirus plasmid |
ORF Viral Vector | pGMAP000256 | Human MBP Adenovirus plasmid |
ORF Viral Vector | vGMLP000535 | Human MBP Lentivirus particle |
ORF Viral Vector | vGMAP000256 | Human MBP Adenovirus particle |
Target information
Target ID | GM-T54761 |
Target Name | MBP |
Gene ID | 4155, 17196, 710350, 24547, 101096421, 476160, 618684, 100063306 |
Gene Symbol and Synonyms | golli-mbp,Hmbpr,jve,MBP,Mbps,mld,shi |
Uniprot Accession | P02686 |
Uniprot Entry Name | MBP_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target |
Disease | Neuromuscular function, subclinical astrogliosis |
Gene Ensembl | ENSG00000197971 |
Target Classification | Not Available |
Note: MBP (Gene ID: 4155) and MBL2 (Gene ID: 4153) share the MBP symbol/alias in common. MBP is a widely used alternative name for mannose binding lectin 2 (MBL2), which can be confused with the official symbol for MBP (myelin basic protein, GeneID 4155). [01 Jun 2018]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.