Human TSHR/hTSHR-I/ LGR3 ORF/cDNA clone-Adenovirus particle (BC024205)
Pre-made Human TSHR/hTSHR-I/ LGR3 Adenovirus for TSHR overexpression in-vitro and in-vivo. The TSHR adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified TSHR-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to TSHR/hTSHR-I products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000258 | Human TSHR Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000258 |
Gene Name | TSHR |
Accession Number | BC024205 |
Gene ID | 7253 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 762 bp |
Gene Alias | hTSHR-I, LGR3 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGGCCGGCGGACTTGCTGCAGCTGGTGCTGCTGCTCGACCTGCCCAGGGACCTGGGCGGAATGGGGTGTTCGTCTCCACCCTGCGAGTGCCATCAGGAGGAGGACTTCAGAGTCACCTGCAAGGATATTCAACGCATCCCCAGCTTACCGCCCAGTACGCAGACTCTGAAGCTTATTGAGACTCACCTGAGAACTATTCCAAGTCATGCATTTTCTAATCTGCCCAATATTTCCAGAATCTACGTATCTATAGATGTGACTCTGCAGCAGCTGGAATCACACTCCTTCTACAATTTGAGTAAAGTGACTCACATAGAAATTCGGAATACCAGGAACTTAACTTACATAGACCCTGATGCCCTCAAAGAGCTCCCCCTCCTAAAGTTCCTTGGCATTTTCAACACTGGACTTAAAATGTTCCCTGACCTGACCAAAGTTTATTCCACTGATATATTCTTTATACTTGAAATTACAGACAACCCTTACATGACGTCAATCCCTGTGAATGCTTTTCAGGGACTATGCAATGAAACCTTGACACTGAAGCTGTACAACAATGGCTTTACTTCAGTCCAAGGATATGCTTTCAATGGGACAAAGCTGGATGCTGTTTACCTAAACAAGAATAAATACCTGACAGTTATTGACAAAGATGCATTTGGAGGAGTATACAGTGGACCAAGCTTGCTGCTACCTCTTGGAAGAAAGTCCTTGTCCTTTGAGACTCAGAAGGCCCCACGCTCCAGTATGCCATCATGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T60606-Ab | Anti-TSHR/ CHNG1/ LGR3 monoclonal antibody |
Target Antigen | GM-Tg-g-T60606-Ag | TSHR VLP (virus-like particle) |
ORF Viral Vector | pGMLV000899 | Human TSHR Lentivirus plasmid |
ORF Viral Vector | pGMLV001265 | Human TSHR Lentivirus plasmid |
ORF Viral Vector | pGMAAV001175 | Human TSHR Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMAP000258 | Human TSHR Adenovirus plasmid |
ORF Viral Vector | vGMLV000899 | Human TSHR Lentivirus particle |
ORF Viral Vector | vGMLV001265 | Human TSHR Lentivirus particle |
ORF Viral Vector | vGMAAV001175 | Human TSHR Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMAP000258 | Human TSHR Adenovirus particle |
Target information
Target ID | GM-T60606 |
Target Name | TSHR |
Gene ID | 7253, 22095, 574251, 25360, 493842, 403968, 281553, 111770367 |
Gene Symbol and Synonyms | CHNG1,hTSHR-I,hypothroid,hyt,LGR3,pet,TSH-R,TSHR,TSHRA |
Uniprot Accession | P16473 |
Uniprot Entry Name | TSHR_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target |
Disease | Cancer |
Gene Ensembl | ENSG00000165409 |
Target Classification | Checkpoint-Immuno Oncology, GPCR, Tumor-associated antigen (TAA) |
The protein encoded by this gene is a membrane protein and a major controller of thyroid cell metabolism. The encoded protein is a receptor for thyrothropin and thyrostimulin, and its activity is mediated by adenylate cyclase. Defects in this gene are a cause of several types of hyperthyroidism. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.