Human EDNRB/ABCDS/ ETB ORF/cDNA clone-Adenovirus particle (BC014472)

Pre-made Human EDNRB/ABCDS/ ETB Adenovirus for EDNRB overexpression in-vitro and in-vivo. The EDNRB adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified EDNRB-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to EDNRB/ABCDS products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000428 Human EDNRB Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000428
Gene Name EDNRB
Accession Number BC014472
Gene ID 1910
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1329 bp
Gene Alias ABCDS, ETB, ETRB, HSCR, HSCR2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGCAGCCGCCTCCAAGTCTGTGCGGACGCGCCCTGGTTGCGCTGGTTCTTGCCTGCGGCCTGTCGCGGATCTGGGGAGAGGAGAGAGGCTTCCCGCCTGACAGGGCCACTCCGCTTTTGCAAACCGCAGAGATAATGACGCCACCCACTAAGACCTTATGGCCCAAGGGTTCCAACGCCAGTCTGGCGCGGTCGTTGGCACCTGCGGAGGTGCCTAAAGGAGACAGGACGGCAGGATCTCCGCCACGCACCATCTCCCCTCCCCCGTGCCAAGGACCCATCGAGATCAAGGAGACTTTCAAATACATCAACACGGTTGTGTCCTGCCTTGTGTTCGTGCTGGGGATCATCGGGAACTCCACACTTCTGAGAATTATCTACAAGAACAAGTGCATGCGAAACGGTCCCAATATCTTGATCGCCAGCTTGGCTCTGGGAGACCTGCTGCACATCGTCATTGACATCCCTATCAATGTCTACAAGCTGCTGGCAGAGGACTGGCCATTTGGAGCTGAGATGTGTAAGCTGGTGCCTTTCATACAGAAAGCCTCCGTGGGAATCACTGTGCTGAGTCTATGTGCTCTGAGTATTGACAGATATCGAGCTGTTGCTTCTTGGAGTAGAATTAAAGGAATTGGGGTTCCAAAATGGACAGCAGTAGAAATTGTTTTGATTTGGGTGGTCTCTGTGGTTCTGGCTGTCCCTGAAGCCATAGGTTTTGATATAATTACGATGGACTACAAAGGAAGTTATCTGCGAATCTGCTTGCTTCATCCCGTTCAGAAGACAGCTTTCATGCAGTTTTACAAGACAGCAAAAGATTGGTGGCTGTTCAGTTTCTATTTCTGCTTGCCATTGGCCATCACTGCATTTTTTTATACACTAATGACCTGTGAAATGTTGAGAAAGAAAAGTGGCATGCAGATTGCTTTAAATGATCACCTAAAGCAGAGACGGGAAGTGGCCAAAACCGTCTTTTGCCTGGTCCTTGTCTTTGCCCTCTGCTGGCTTCCCCTTCACCTCAGCAGGATTCTGAAGCTCACTCTTTATAATCAGAATGATCCCAATAGATGTGAACTTTTGAGCTTTCTGTTGGTATTGGACTATATTGGTATCAACATGGCTTCACTGAATTCCTGCATTAACCCAATTGCTCTGTATTTGGTGAGCAAAAGATTCAAAAACTGCTTTAAGTCATGCTTATGCTGCTGGTGCCAGTCATTTGAAGAAAAACAGTCCTTGGAGGAAAAGCAGTCGTGCTTAAAGTTCAAAGCTAATGATCACGGATATGACAACTTCCGTTCCAGTAATAAATACAGCTCATCTTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T92828-Ab Anti-EDNRB/ ABCDS/ ET-B monoclonal antibody
    Target Antigen GM-Tg-g-T92828-Ag EDNRB VLP (virus-like particle)
    ORF Viral Vector pGMAP000428 Human EDNRB Adenovirus plasmid
    ORF Viral Vector vGMAP000428 Human EDNRB Adenovirus particle


    Target information

    Target ID GM-T92828
    Target Name EDNRB
    Gene ID 1910, 13618, 697329, 50672, 101086531, 403862, 281750, 100033875
    Gene Symbol and Synonyms ABCDS,Ednra,EDNRB,ET-B,ET-BR,ETB,ETB1,ETBR,ETR-b,ETRB,HSCR,HSCR2,Sox10m1,WS4A
    Uniprot Accession P24530
    Uniprot Entry Name EDNRB_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000136160
    Target Classification GPCR, Tumor-associated antigen (TAA)

    The protein encoded by this gene is a G protein-coupled receptor which activates a phosphatidylinositol-calcium second messenger system. Its ligand, endothelin, consists of a family of three potent vasoactive peptides: ET1, ET2, and ET3. Studies suggest that the multigenic disorder, Hirschsprung disease type 2, is due to mutations in the endothelin receptor type B gene. Alternative splicing and the use of alternative promoters results in multiple transcript variants. [provided by RefSeq, Oct 2016]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.