Human MUC1/CD227/ EMA ORF/cDNA clone-Adenovirus particle (BC120975)

Pre-made Human MUC1/CD227/ EMA Adenovirus for MUC1 overexpression in-vitro and in-vivo. The MUC1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified MUC1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collectionGo to MUC1/CD227 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000530 Human MUC1 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000530
Gene Name MUC1
Accession Number BC120975
Gene ID 4582
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 795 bp
Gene Alias CD227, EMA, H23AG, MAM6, PEM, PEMT
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACACCGGGCACCCAGTCTCCTTTCTTCCTGCTGCTGCTCCTCACAGTGCTTACAGCTACCACAGCCCCTAAACCCGCAACAGTTGTTACGGGTTCTGGTCATGCAAGCTCTACCCCAGGTGGAGAAAAGGAGACTTCGGCTACCCAGAGAAGTTCAGTGCCCAGCTCTACTGAGAAGAATGCTTTTAATTCCTCTCTGGAAGATCCCAGCACCGACTACTACCAAGAGCTGCAGAGAGACATTTCTGAAATGTTTTTGCAGATTTATAAACAAGGGGGTTTTCTGGGCCTCTCCAATATTAAGTTCAGGCCAGGATCTGTGGTGGTACAATTGACTCTGGCCTTCCGAGAAGGTACCATCAATGTCCACGACGTGGAGACACAGTTCAATCAGTATAAAACGGAAGCAGCCTCTCGATATAACCTGACGATCTCAGACGTCAGCGTGAGTGATGTGCCATTTCCTTTCTCTGCCCAGTCTGGGGCTGGGGTGCCAGGCTGGGGCATCGCGCTGCTGGTGCTGGTCTGTGTTCTGGTTGCGCTGGCCATTGTCTATCTCATTGCCTTGGCTGTCTGTCAGTGCCGCCGAAAGAACTACGGGCAGCTGGACATCTTTCCAGCCCGGGATACCTACCATCCTATGAGCGAGTACCCCACCTACCACACCCATGGGCGCTATGTGCCCCCTAGCAGTACCGATCGTAGCCCCTATGAGAAGGTTTCTGCAGGTAATGGTGGCAGCAGCCTCTCTTACACAAACCCAGCAGTGGCAGCCACTTCTGCCAACTTGTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-770 Pre-Made Cantuzumab Ravtansine Biosimilar, Whole Mab Adc, Anti-Muc1 Antibody: Anti-ADMCKD/ADMCKD1/ADTKD2/CA 15-3/CD227/Ca15-3/EMA/H23AG/KL-6/MAM6/MCD/MCKD/MCKD1/SEC/X/ZD/PEM/PEMT/PUM therapeutic antibody Drug Conjugate
    Biosimilar GMP-Bios-INN-1052 Pre-Made Yttrium (90Y) Clivatuzumab Tetraxetan Biosimilar, Radiolabelled Antibody, Anti-Muc1 Antibody: Anti-ADMCKD/ADMCKD1/ADTKD2/CA 15-3/CD227/Ca15-3/EMA/H23AG/KL-6/MAM6/MCD/MCKD/MCKD1/SEC/X/ZD/PEM/PEMT/PUM therapeutic antibody
    Biosimilar GMP-Bios-INN-769 Pre-Made Cantuzumab Mertansine Biosimilar, Whole Mab Adc, Anti-Muc1 Antibody: Anti-ADMCKD/ADMCKD1/ADTKD2/CA 15-3/CD227/Ca15-3/EMA/H23AG/KL-6/MAM6/MCD/MCKD/MCKD1/SEC/X/ZD/PEM/PEMT/PUM therapeutic antibody Drug Conjugate
    Biosimilar GMP-Bios-INN-997 Pre-Made Sontuzumab Biosimilar, Whole Mab, Anti-Muc1 Antibody: Anti-ADMCKD/ADMCKD1/ADTKD2/CA 15-3/CD227/Ca15-3/EMA/H23AG/KL-6/MAM6/MCD/MCKD/MCKD1/SEC/X/ZD/PEM/PEMT/PUM therapeutic antibody
    Biosimilar GMP-Bios-ab-236 Pre-Made Gatipotuzumab biosimilar, Whole mAb, Anti-MUC1 Antibody: Anti-ADMCKD/ADMCKD1/ADTKD2/CA 15-3/CD227/Ca15-3/EMA/H23AG/KL-6/MAM6/MCD/MCKD/MCKD1/SEC/X/ZD/PEM/PEMT/PUM therapeutic antibody
    Biosimilar GMP-Bios-ab-112 Pre-Made Clivatuzumab biosimilar, Whole mAb Radiolabelled, Anti-MUC1 Antibody: Anti-ADMCKD/ADMCKD1/ADTKD2/CA 15-3/CD227/Ca15-3/EMA/H23AG/KL-6/MAM6/MCD/MCKD/MCKD1/SEC/X/ZD/PEM/PEMT/PUM therapeutic antibody
    Biosimilar GMP-Bios-ab-092 Pre-Made Cantuzumab biosimilar, Whole mAb ADC, Anti-MUC1 Antibody: Anti-ADMCKD/ADMCKD1/ADTKD2/CA 15-3/CD227/Ca15-3/EMA/H23AG/KL-6/MAM6/MCD/MCKD/MCKD1/SEC/X/ZD/PEM/PEMT/PUM therapeutic antibody
    Biosimilar GMP-Bios-INN-922 Pre-Made Nacolomab Tafenatox biosimilar, Fusion Protein, Nacolomab-Anti-MUC1 Antibody: Anti-ADMCKD/ADMCKD1/ADTKD2/CA 15-3/CD227/Ca15-3/EMA/H23AG/KL-6/MAM6/MCD/MCKD/MCKD1/SEC/X/ZD/PEM/PEMT/PUM therapeutic antibody fused with Staphylococcus aureus enterotoxin A
    Biosimilar GMP-Bios-INN-784 Pre-Made Clivatuzumab Tetraxetan Biosimilar, Whole Mab Adc, Anti-Muc1 Antibody: Anti-ADMCKD/ADMCKD1/ADTKD2/CA 15-3/CD227/Ca15-3/EMA/H23AG/KL-6/MAM6/MCD/MCKD/MCKD1/SEC/X/ZD/PEM/PEMT/PUM therapeutic antibody Drug Conjugate
    Biosimilar GMP-Bios-ab-426 Pre-Made PankoMab biosimilar, Whole mAb, Anti-MUC1 Antibody: Anti-ADMCKD/ADMCKD1/ADTKD2/CA 15-3/CD227/Ca15-3/EMA/H23AG/KL-6/MAM6/MCD/MCKD/MCKD1/SEC/X/ZD/PEM/PEMT/PUM therapeutic antibody
    Biosimilar GMP-Bios-INN-839 Pre-Made Epitumomab Cituxetan Biosimilar, Radiolabelled Antibody, Anti-Muc1 Antibody: Anti-ADMCKD/ADMCKD1/ADTKD2/CA 15-3/CD227/Ca15-3/EMA/H23AG/KL-6/MAM6/MCD/MCKD/MCKD1/SEC/X/ZD/PEM/PEMT/PUM therapeutic antibody
    Target Antibody GM-Tg-g-T18779-Ab Anti-MUC1/ ADMCKD/ ADMCKD1 monoclonal antibody
    Target Antigen GM-Tg-g-T18779-Ag MUC1 VLP (virus-like particle)
    ORF Viral Vector pGMAD000096 Human MUC1 Adenovirus plasmid
    ORF Viral Vector pGMAD000430 Human MUC1 Adenovirus plasmid
    ORF Viral Vector pGMLP000558 Human MUC1 Lentivirus plasmid
    ORF Viral Vector pGMAP000530 Human MUC1 Adenovirus plasmid
    ORF Viral Vector vGMAD000096 Human MUC1 Adenovirus particle
    ORF Viral Vector vGMAD000430 Human MUC1 Adenovirus particle
    ORF Viral Vector vGMLP000558 Human MUC1 Lentivirus particle
    ORF Viral Vector vGMAP000530 Human MUC1 Adenovirus particle


    Target information

    Target ID GM-T18779
    Target Name MUC1
    Gene ID 4582, 17829, 717546, 24571, 101093832, 448784, 281333, 100063415
    Gene Symbol and Synonyms ADMCKD,ADMCKD1,ADTKD2,CA 15-3,Ca15-3,CD227,EMA,H23AG,KL-6,MAM6,MCD,MCKD,MCKD1,MUC-1,MUC-1/SEC,MUC-1/X,MUC1,MUC1/ZD,mucin,PEM,PEMT,PUM
    Uniprot Accession P15941
    Uniprot Entry Name MUC1_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease Ovary Cancer
    Gene Ensembl ENSG00000185499
    Target Classification Checkpoint-Immuno Oncology

    This gene encodes a membrane-bound protein that is a member of the mucin family. Mucins are O-glycosylated proteins that play an essential role in forming protective mucous barriers on epithelial surfaces. These proteins also play a role in intracellular signaling. This protein is expressed on the apical surface of epithelial cells that line the mucosal surfaces of many different tissues including lung, breast stomach and pancreas. This protein is proteolytically cleaved into alpha and beta subunits that form a heterodimeric complex. The N-terminal alpha subunit functions in cell-adhesion and the C-terminal beta subunit is involved in cell signaling. Overexpression, aberrant intracellular localization, and changes in glycosylation of this protein have been associated with carcinomas. This gene is known to contain a highly polymorphic variable number tandem repeats (VNTR) domain. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Feb 2011]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.