- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
Sample Application
- • Animal health test
- • In-vitro diagnostics
- • Food & Feed Safety
- • Environmental Safety
- • New drug discovery
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Rat Cldn1 ORF/cDNA clone-Adenovirus particle (NM_031699)
Pre-made Rat Cldn1/ Adenovirus for Cldn1 overexpression in-vitro and in-vivo. The Cldn1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified Cldn1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to CLDN1/Cldn1/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAP000567 | Rat Cldn1 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAP000567 |
| Gene Name | Cldn1 |
| Accession Number | NM_031699 |
| Gene ID | 65129 |
| Species | Rat |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 636 bp |
| Gene Alias | |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| Sequence | ATGGCCAACGCGGGGTTGCAGCTTCTGGGTTTCATCCTGGCTTCGCTGGGATGGATCGGCTCTATCGTCAGCACTGCCCTGCCCCAATGGAAGATTTACTCCTATGCTGGGGACAACATCGTGACTGCTCAGGCCATCTACGAGGGACTGTGGATGTCCTGCGTTTCGCAAAGCACCGGGCAGATACAGTGCAAAGTCTTCGACTCCTTGCTGAATCTGAATAGTACTTTGCAGGCAACCAGAGCCTTGATGGTAATTGGCATCCTGCTGGGGCTGATCGCAATCTTTGTGTCCACCATTGGCATGAAGTGCATGAGGTGCTTAGAAGATGATGAAGTGCAAAAGATGTGGATGGCTGTCATCGGGGGCATAATATTTGTAATTTCAGGTCTGGCGACATTAGTGGCCACAGCATGGTATGGAAATAGAATTGTTCAAGAATTCTATGACCCCATGACCCCTATCAATGCCAGGTATGAATTTGGCCAGGCTCTCTTTACTGGCTGGGCTGCTGCCTCCCTCTGCCTCCTGGGAGGTGCCCTACTTTCCTGCTCCTGTCCCCGGAAAACAACCTCTTACCCAACACCACGGCCTTATCCCAAGCCAACACCTTCTACTGGGAAAGACTACGTGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-MP0271-Ab | Anti-CLD1/ CLDN1/ ILVASC monoclonal antibody |
| Target Antigen | GM-Tg-g-MP0271-Ag | CLDN1 VLP (virus-like particle) |
| ORF Viral Vector | pGMLV000077 | Human CLDN1 Lentivirus plasmid |
| ORF Viral Vector | pGMLV001928 | Human CLDN1 Lentivirus plasmid |
| ORF Viral Vector | pGMAAV001060 | Rat Cldn1 Adeno-associate virus(AAV) plasmid |
| ORF Viral Vector | pGMAAV001101 | Rat Cldn1 Adeno-associate virus(AAV) plasmid |
| ORF Viral Vector | pGMPC000975 | Human CLDN1 Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | pGMAP000567 | Rat Cldn1 Adenovirus plasmid |
| ORF Viral Vector | vGMLV000077 | Human CLDN1 Lentivirus particle |
| ORF Viral Vector | vGMLV001928 | Human CLDN1 Lentivirus particle |
| ORF Viral Vector | vGMAAV001060 | Rat Cldn1 Adeno-associate virus(AAV) particle |
| ORF Viral Vector | vGMAAV001101 | Rat Cldn1 Adeno-associate virus(AAV) particle |
| ORF Viral Vector | vGMAP000567 | Rat Cldn1 Adenovirus particle |
Target information
| Target ID | GM-MP0271 |
| Target Name | CLDN1 |
| Gene ID | 9076, 12737, 704330, 65129, 101094619, 608207, 414922, 100059811 |
| Gene Symbol and Synonyms | claudin-1,CLD1,CLDN1,ILVASC,SEMP1 |
| Uniprot Accession | O95832 |
| Uniprot Entry Name | CLD1_HUMAN |
| Protein Sub-location | Transmembrane Protein |
| Category | Not Available |
| Disease | Cancer |
| Gene Ensembl | ENSG00000163347 |
| Target Classification | Tumor-associated antigen (TAA) |
Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. These junctions are comprised of sets of continuous networking strands in the outwardly facing cytoplasmic leaflet, with complementary grooves in the inwardly facing extracytoplasmic leaflet. The protein encoded by this gene, a member of the claudin family, is an integral membrane protein and a component of tight junction strands. Loss of function mutations result in neonatal ichthyosis-sclerosing cholangitis syndrome. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
