- • Up to 20%-50%* off first purchase
- • Bulk quantities available
- • Citation Reward application
Sample Application
- • Animal health test
- • In-vitro diagnostics
- • Food & Feed Safety
- • Environmental Safety
- • New drug discovery
Supports
- Talk to our Expert:
[email protected] -
Talk to our sales:
[email protected]
Protocol Library Download
 |
 |
Human CALR/cC1qR/ CRT ORF/cDNA clone-Lentivirus particle (NM_004343)
Pre-made Human CALR/cC1qR/ CRT Lentiviral expression plasmid for CALR lentivirus packaging, CALR lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to CALR/cC1qR products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP000141 | Human CALR Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP000141 |
| Gene Name | CALR |
| Accession Number | NM_004343 |
| Gene ID | 811 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 1254 bp |
| Gene Alias | cC1qR, CRT, HEL-S-99n, RO, SSA |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| Sequence | ATGCTGCTATCCGTGCCGCTGCTGCTCGGCCTCCTCGGCCTGGCCGTCGCCGAGCCTGCCGTCTACTTCAAGGAGCAGTTTCTGGACGGAGACGGGTGGACTTCCCGCTGGATCGAATCCAAACACAAGTCAGATTTTGGCAAATTCGTTCTCAGTTCCGGCAAGTTCTACGGTGACGAGGAGAAAGATAAAGGTTTGCAGACAAGCCAGGATGCACGCTTTTATGCTCTGTCGGCCAGTTTCGAGCCTTTCAGCAACAAAGGCCAGACGCTGGTGGTGCAGTTCACGGTGAAACATGAGCAGAACATCGACTGTGGGGGCGGCTATGTGAAGCTGTTTCCTAATAGTTTGGACCAGACAGACATGCACGGAGACTCAGAATACAACATCATGTTTGGTCCCGACATCTGTGGCCCTGGCACCAAGAAGGTTCATGTCATCTTCAACTACAAGGGCAAGAACGTGCTGATCAACAAGGACATCCGTTGCAAGGATGATGAGTTTACACACCTGTACACACTGATTGTGCGGCCAGACAACACCTATGAGGTGAAGATTGACAACAGCCAGGTGGAGTCCGGCTCCTTGGAAGACGATTGGGACTTCCTGCCACCCAAGAAGATAAAGGATCCTGATGCTTCAAAACCGGAAGACTGGGATGAGCGGGCCAAGATCGATGATCCCACAGACTCCAAGCCTGAGGACTGGGACAAGCCCGAGCATATCCCTGACCCTGATGCTAAGAAGCCCGAGGACTGGGATGAAGAGATGGACGGAGAGTGGGAACCCCCAGTGATTCAGAACCCTGAGTACAAGGGTGAGTGGAAGCCCCGGCAGATCGACAACCCAGATTACAAGGGCACTTGGATCCACCCAGAAATTGACAACCCCGAGTATTCTCCCGATCCCAGTATCTATGCCTATGATAACTTTGGCGTGCTGGGCCTGGACCTCTGGCAGGTCAAGTCTGGCACCATCTTTGACAACTTCCTCATCACCAACGATGAGGCATACGCTGAGGAGTTTGGCAACGAGACGTGGGGCGTAACAAAGGCAGCAGAGAAACAAATGAAGGACAAACAGGACGAGGAGCAGAGGCTTAAGGAGGAGGAAGAAGACAAGAAACGCAAAGAGGAGGAGGAGGCAGAGGACAAGGAGGATGATGAGGACAAAGATGAGGATGAGGAGGATGAGGAGGACAAGGAGGAAGATGAGGAGGAAGATGTCCCCGGCCAGGCCAAGGACGAGCTGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T79821-Ab | Anti-CALR/ CRT/ HEL-S-99n functional antibody |
| Target Antigen | GM-Tg-g-T79821-Ag | CALR protein |
| ORF Viral Vector | pGMAD000312 | Rat Calr Adenovirus plasmid |
| ORF Viral Vector | pGMPC000518 | Human CALR Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | pGMPC000799 | Human CALR Mammalian (Non-Viral Vector) plasmid |
| ORF Viral Vector | pGMLP000141 | Human CALR Lentivirus plasmid |
| ORF Viral Vector | pGMAP000540 | / Adenovirus plasmid |
| ORF Viral Vector | vGMAD000312 | Rat Calr Adenovirus particle |
| ORF Viral Vector | vGMLP000141 | Human CALR Lentivirus particle |
| ORF Viral Vector | vGMAP000540 | / Adenovirus particle |
Target information
| Target ID | GM-T79821 |
| Target Name | CALR |
| Gene ID | 811, 12317, 716910, 64202, 101087384, 476694, 281036, 100064107 |
| Gene Symbol and Synonyms | CALR,CALR1,Calregulin,cC1qR,CRP55,CRT,ERp60,HACBP,HEL-S-99n,RO,SSA |
| Uniprot Accession | P27797 |
| Uniprot Entry Name | CALR_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target, Immuno-oncology Target |
| Disease | Prostate Cancer, Malignant neoplasm of bladder |
| Gene Ensembl | ENSG00000179218 |
| Target Classification | Checkpoint-Immuno Oncology |
Calreticulin is a highly conserved chaperone protein which resides primarily in the endoplasmic reticulum, and is involved in a variety of cellular processes, among them, cell adhesion. Additionally, it functions in protein folding quality control and calcium homeostasis. Calreticulin is also found in the nucleus, suggesting that it may have a role in transcription regulation. Systemic lupus erythematosus is associated with increased autoantibody titers against calreticulin. Recurrent mutations in calreticulin have been linked to various neoplasms, including the myeloproliferative type.[provided by RefSeq, May 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.
Facebook
LinkedIn
Twitter
