Human CLN8/C8orf61/EPMR ORF/cDNA clone-Lentivirus particle (NM_018941)

Cat. No.: vGMLP000179

Pre-made Human CLN8/C8orf61/EPMR Lentiviral expression plasmid for CLN8 lentivirus packaging, CLN8 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to CLN8/C8orf61 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000179 Human CLN8 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000179
Gene Name CLN8
Accession Number NM_018941
Gene ID 2055
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 861 bp
Gene Alias C8orf61,EPMR
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAATCCTGCGAGCGATGGGGGCACATCAGAGAGCATTTTTGACCTGGACTATGCATCCTGGGGGATCCGCTCCACGCTGATGGTCGCTGGCTTTGTCTTCTACTTGGGCGTCTTTGTGGTCTGCCACCAGCTGTCCTCTTCCCTGAATGCCACTTACCGTTCTTTGGTGGCCAGAGAGAAGGTCTTCTGGGACCTGGCGGCCACGCGTGCAGTCTTTGGTGTTCAGAGCACAGCCGCAGGCCTGTGGGCTCTGCTGGGGGACCCTGTGCTGCATGCCGACAAGGCGCGTGGCCAGCAGAACTGGTGCTGGTTTCACATCACGACAGCAACGGGATTCTTTTGCTTTGAAAATGTTGCAGTCCACCTGTCCAACTTGATCTTCCGGACATTTGACTTGTTTCTGGTTATCCACCATCTCTTTGCCTTTCTTGGGTTTCTTGGCTGCTTGGTCAATCTCCAAGCTGGCCACTATCTAGCTATGACCACGTTGCTCCTGGAGATGAGCACGCCCTTTACCTGCGTTTCCTGGATGCTCTTAAAGGCGGGCTGGTCCGAGTCTCTGTTTTGGAAGCTCAACCAGTGGCTGATGATTCACATGTTTCACTGCCGCATGGTTCTAACCTACCACATGTGGTGGGTGTGTTTCTGGCACTGGGACGGCCTGGTCAGCAGCCTGTATCTGCCTCATTTGACACTGTTCCTTGTCGGACTGGCTCTGCTTACGCTAATCATTAATCCATATTGGACCCATAAGAAGACTCAGCAGCTTCTCAATCCGGTGGACTGGAACTTCGCACAGCCAGAAGCCAAGAGCAGGCCAGAAGGCAACGGGCAGCTGCTGCGGAAGAAGAGGCCATAG
ORF Protein Sequence MNPASDGGTSESIFDLDYASWGIRSTLMVAGFVFYLGVFVVCHQLSSSLNATYRSLVAREKVFWDLAATRAVFGVQSTAAGLWALLGDPVLHADKARGQQNWCWFHITTATGFFCFENVAVHLSNLIFRTFDLFLVIHHLFAFLGFLGCLVNLQAGHYLAMTTLLLEMSTPFTCVSWMLLKAGWSESLFWKLNQWLMIHMFHCRMVLTYHMWWVCFWHWDGLVSSLYLPHLTLFLVGLALLTLIINPYWTHKKTQQLLNPVDWNFAQPEAKSRPEGNGQLLRKKRP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0563-Ab Anti-CLN8 monoclonal antibody
    Target Antigen GM-Tg-g-IP0563-Ag CLN8 protein
    ORF Viral Vector pGMLP000179 Human CLN8 Lentivirus plasmid
    ORF Viral Vector vGMLP000179 Human CLN8 Lentivirus particle


    Target information

    Target ID GM-IP0563
    Target Name CLN8
    Gene ID 2055, 26889, 716441, 306619, 101100714, 488558, 530874, 100065372
    Gene Symbol and Synonyms C8orf61,CLN8,EPMR,mnd,TLCD6
    Uniprot Accession Q9UBY8
    Uniprot Entry Name CLN8_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000182372
    Target Classification Not Available

    This gene encodes a transmembrane protein belonging to a family of proteins containing TLC domains, which are postulated to function in lipid synthesis, transport, or sensing. The protein localizes to the endoplasmic reticulum (ER), and may recycle between the ER and ER-Golgi intermediate compartment. Mutations in this gene are associated with a disorder characterized by progressive epilepsy with cognitive disabilities (EPMR), which is a subtype of neuronal ceroid lipofuscinoses (NCL). Patients with mutations in this gene have altered levels of sphingolipid and phospholipids in the brain. [provided by RefSeq, Jul 2017]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.