Human UBE2B/E2-17kDa/HHR6B ORF/cDNA clone-Lentivirus particle (NM_003337)

Cat. No.: vGMLP000343

Pre-made Human UBE2B/E2-17kDa/HHR6B Lentiviral expression plasmid for UBE2B lentivirus packaging, UBE2B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to UBE2B/E2-17kDa products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000343 Human UBE2B Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000343
Gene Name UBE2B
Accession Number NM_003337
Gene ID 7320
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 459 bp
Gene Alias E2-17kDa,HHR6B,HR6B,RAD6B,UBC2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCGACCCCGGCCCGGAGGAGGCTCATGCGGGATTTCAAGCGGTTACAAGAGGACCCACCTGTGGGTGTCAGTGGCGCACCATCTGAAAACAACATCATGCAGTGGAATGCAGTTATATTTGGACCAGAAGGGACACCTTTTGAAGATGGTACTTTTAAACTAGTAATAGAATTTTCTGAAGAATATCCAAATAAACCACCAACTGTTAGGTTTTTATCCAAAATGTTTCATCCAAATGTGTATGCTGATGGTAGCATATGTTTAGATATCCTTCAGAATCGATGGAGTCCAACATATGATGTATCTTCTATCTTAACATCAATTCAGTCTCTGCTGGATGAACCGAATCCTAACAGTCCAGCCAATAGCCAGGCAGCACAGCTTTATCAGGAAAACAAACGAGAATATGAGAAAAGAGTTTCGGCCATTGTTGAACAAAGCTGGAATGATTCATAA
ORF Protein Sequence MSTPARRRLMRDFKRLQEDPPVGVSGAPSENNIMQWNAVIFGPEGTPFEDGTFKLVIEFSEEYPNKPPTVRFLSKMFHPNVYADGSICLDILQNRWSPTYDVSSILTSIQSLLDEPNPNSPANSQAAQLYQENKREYEKRVSAIVEQSWNDS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2371-Ab Anti-UBE2B/ E2-17kDa/ HHR6B monoclonal antibody
    Target Antigen GM-Tg-g-MP2371-Ag UBE2B VLP (virus-like particle)
    ORF Viral Vector pGMLP000343 Human UBE2B Lentivirus plasmid
    ORF Viral Vector vGMLP000343 Human UBE2B Lentivirus particle


    Target information

    Target ID GM-MP2371
    Target Name UBE2B
    Gene ID 7320, 22210, 710678, 81816, 101099525, 474683, 512207, 100062920
    Gene Symbol and Synonyms E2-14k,E2-17kDa,E214K,HHR6B,HR6B,mHR6B,RAD6B,UBC2,UBE2B
    Uniprot Accession P63146
    Uniprot Entry Name UBE2B_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000119048
    Target Classification Not Available

    The modification of proteins with ubiquitin is an important cellular mechanism for targeting abnormal or short-lived proteins for degradation. Ubiquitination involves at least three classes of enzymes: ubiquitin-activating enzymes, or E1s, ubiquitin-conjugating enzymes, or E2s, and ubiquitin-protein ligases, or E3s. This gene encodes a member of the E2 ubiquitin-conjugating enzyme family. This enzyme is required for post-replicative DNA damage repair. Its protein sequence is 100% identical to the mouse, rat, and rabbit homologs, which indicates that this enzyme is highly conserved in eukaryotic evolution. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.