Human TPT1/HRF/p02 ORF/cDNA clone-Lentivirus particle (NM_003295)

Cat. No.: vGMLP000637

Pre-made Human TPT1/HRF/p02 Lentiviral expression plasmid for TPT1 lentivirus packaging, TPT1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to TPT1/HRF products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000637 Human TPT1 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000637
Gene Name TPT1
Accession Number NM_003295
Gene ID 7178
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 519 bp
Gene Alias HRF,p02,p23,TCTP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGATTATCTACCGGGACCTCATCAGCCACGATGAGATGTTCTCCGACATCTACAAGATCCGGGAGATCGCGGACGGGTTGTGCCTGGAGGTGGAGGGGAAGATGGTCAGTAGGACAGAAGGTAACATTGATGACTCGCTCATTGGTGGAAATGCCTCCGCTGAAGGCCCCGAGGGCGAAGGTACCGAAAGCACAGTAATCACTGGTGTCGATATTGTCATGAACCATCACCTGCAGGAAACAAGTTTCACAAAAGAAGCCTACAAGAAGTACATCAAAGATTACATGAAATCAATCAAAGGGAAACTTGAAGAACAGAGACCAGAAAGAGTAAAACCTTTTATGACAGGGGCTGCAGAACAAATCAAGCACATCCTTGCTAATTTCAAAAACTACCAGTTCTTTATTGGTGAAAACATGAATCCAGATGGCATGGTTGCTCTATTGGACTACCGTGAGGATGGTGTGACCCCATATATGATTTTCTTTAAGGATGGTTTAGAAATGGAAAAATGTTAA
ORF Protein Sequence MIIYRDLISHDEMFSDIYKIREIADGLCLEVEGKMVSRTEGNIDDSLIGGNASAEGPEGEGTESTVITGVDIVMNHHLQETSFTKEAYKKYIKDYMKSIKGKLEEQRPERVKPFMTGAAEQIKHILANFKNYQFFIGENMNPDGMVALLDYREDGVTPYMIFFKDGLEMEKC

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T77473-Ab Anti-TPT1 monoclonal antibody
    Target Antigen GM-Tg-g-T77473-Ag TPT1 protein
    ORF Viral Vector pGMLP000637 Human TPT1 Lentivirus plasmid
    ORF Viral Vector pGMLV001169 Human TPT1 Lentivirus plasmid
    ORF Viral Vector vGMLP000637 Human TPT1 Lentivirus particle
    ORF Viral Vector vGMLV001169 Human TPT1 Lentivirus particle


    Target information

    Target ID GM-T77473
    Target Name TPT1
    Gene ID 7178, 22070, 702155, 116646, 101083564, 476924, 326599, 100059158
    Gene Symbol and Synonyms HRF,p02,p21,p23,TCTP,TPT1,Trt
    Uniprot Accession P13693
    Uniprot Entry Name TCTP_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Cancer
    Gene Ensembl ENSG00000133112
    Target Classification Tumor-associated antigen (TAA)

    This gene encodes a protein that is a regulator of cellular growth and proliferation. Its mRNA is highly structured and contains an oligopyrimidine tract (5'-TOP) in its 5' untranslated region that functions to repress its translation under quiescent conditions. The encoded protein is involved in a variety of cellular pathways, including apoptosis, protein synthesis and cell division. It binds to and stabilizes microtubules, and removal of this protein through phosphorylation is required for progression through mitotic and meiotic cell divisions. This gene is known to play a role in carcinogenesis, and is upregulated in some cancer cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2017]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.