Human TPT1/HRF/p02 ORF/cDNA clone-Lentivirus particle (NM_003295.4)
Cat. No.: vGMLV001169
Pre-made Human TPT1/HRF/p02 Lentiviral expression plasmid for TPT1 lentivirus packaging, TPT1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
TPT1/HRF products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLV001169 | Human TPT1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLV001169 |
| Gene Name | TPT1 |
| Accession Number | NM_003295.4 |
| Gene ID | 7178 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 519 bp |
| Gene Alias | HRF,p02,p23,TCTP |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGATTATCTACCGGGACCTCATCAGCCACGATGAGATGTTCTCCGACATCTACAAGATCCGGGAGATCGCGGACGGGTTGTGCCTGGAGGTGGAGGGGAAGATGGTCAGTAGGACAGAAGGTAACATTGATGACTCGCTCATTGGTGGAAATGCCTCCGCTGAAGGCCCCGAGGGCGAAGGTACCGAAAGCACAGTAATCACTGGTGTCGATATTGTCATGAACCATCACCTGCAGGAAACAAGTTTCACAAAAGAAGCCTACAAGAAGTACATCAAAGATTACATGAAATCAATCAAAGGGAAACTTGAAGAACAGAGACCAGAAAGAGTAAAACCTTTTATGACAGGGGCTGCAGAACAAATCAAGCACATCCTTGCTAATTTCAAAAACTACCAGTTCTTTATTGGTGAAAACATGAATCCAGATGGCATGGTTGCTCTATTGGACTACCGTGAGGATGGTGTGACCCCATATATGATTTTCTTTAAGGATGGTTTAGAAATGGAAAAATGTTAA |
| ORF Protein Sequence | MIIYRDLISHDEMFSDIYKIREIADGLCLEVEGKMVSRTEGNIDDSLIGGNASAEGPEGEGTESTVITGVDIVMNHHLQETSFTKEAYKKYIKDYMKSIKGKLEEQRPERVKPFMTGAAEQIKHILANFKNYQFFIGENMNPDGMVALLDYREDGVTPYMIFFKDGLEMEKC |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T77473-Ab | Anti-TPT1 monoclonal antibody |
| Target Antigen | GM-Tg-g-T77473-Ag | TPT1 protein |
| ORF Viral Vector | pGMLP000637 | Human TPT1 Lentivirus plasmid |
| ORF Viral Vector | pGMLV001169 | Human TPT1 Lentivirus plasmid |
| ORF Viral Vector | vGMLP000637 | Human TPT1 Lentivirus particle |
| ORF Viral Vector | vGMLV001169 | Human TPT1 Lentivirus particle |
Target information
| Target ID | GM-T77473 |
| Target Name | TPT1 |
| Gene ID | 7178, 22070, 702155, 116646, 101083564, 476924, 326599, 100059158 |
| Gene Symbol and Synonyms | HRF,p02,p21,p23,TCTP,TPT1,Trt |
| Uniprot Accession | P13693 |
| Uniprot Entry Name | TCTP_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target |
| Disease | Cancer |
| Gene Ensembl | ENSG00000133112 |
| Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a protein that is a regulator of cellular growth and proliferation. Its mRNA is highly structured and contains an oligopyrimidine tract (5'-TOP) in its 5' untranslated region that functions to repress its translation under quiescent conditions. The encoded protein is involved in a variety of cellular pathways, including apoptosis, protein synthesis and cell division. It binds to and stabilizes microtubules, and removal of this protein through phosphorylation is required for progression through mitotic and meiotic cell divisions. This gene is known to play a role in carcinogenesis, and is upregulated in some cancer cells. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2017]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


